1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ratelena [41]
4 years ago
8

Name the type of force that occurs when Earth’s crust is pulled in opposite directions.

Biology
1 answer:
Alekssandra [29.7K]4 years ago
6 0
The answer should be
Shear stress
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What are some ways that the biosphere interacts with the other three systems?
Svetach [21]

Answer:

Plants (biosphere) draw water (hydrosphere) and nutrients from the soil (geosphere) and release water vapor into the atmosphere. Humans (biosphere) use farm machinery (manufactured from geosphere materials) to plow the fields, and the atmosphere brings precipitation (hydrosphere) to water the plants.

Explanation:

8 0
2 years ago
Read 2 more answers
What's unit for electrical power
lyudmila [28]
The unit is the Watt. S.I. unit = W
4 0
4 years ago
1. Which kind of evidence did scientists use to determine that some animals moved back to a marine life after first evolving as
sergey [27]
The answer is d i think.....
8 0
3 years ago
Read 2 more answers
How is an organism related to a population? A. The same species of organisms from one geographic area make up a population. B. S
Rzqust [24]

Answer:

A. The same species of organisms from one geographic area make up a population.

Explanation:

  • Population refers to a group of organisms of the same species living in the same geographical area at the same time. Therefore organisms of similar species make up a population.
  • Several populations in turn make up a community. This explains why a community refers to groups of different species living in the same geographical area or an ecosystem.
6 0
3 years ago
Other questions:
  • What process does granite go through during its formation
    12·1 answer
  • Which of the following is a disadvantage of wind as an energy source?
    8·1 answer
  • In dominnt/recessive inheritance patter,s the dominant allele is always expressed when present. the recessive allele is only exp
    15·1 answer
  • What impact do nuclear power plants have on water resources?
    5·1 answer
  • The myocardium receives its blood supply from the coronary arteries. True or False
    11·1 answer
  • Which of the following is used in medical imagery?
    14·2 answers
  • What is the smallest functional unit of a living thing
    11·2 answers
  • Transdermal patches are intended to release a drug over an extended period of time. Particular care must be used with this type
    5·1 answer
  • Do y’all know each of these ?<br> HELP PLEASE !!!
    11·2 answers
  • How does burning fossil fuels cause an increase of carbon in the air?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!