1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marina86 [1]
3 years ago
14

The bones in the wings of birds and bats are _______ because they derived from a _______ ancestor, while the wings are _______ t

raits.
homologs; common; homologous
homologous; common; homoplastic
homologous; different; homoplastic
homoplasies; different; homologous
homologs; common; nonhomologous
Biology
1 answer:
ira [324]3 years ago
6 0
Hey there,

Question : <span>The bones in the wings of birds and bats are _______ because they derived from a _______ ancestor, while the wings are _______ traits. 

Answer : </span><span>homologous; common; homoplastic 

Hope this helps :))

<em>~Top♥</em>
</span>
You might be interested in
When the oxygen is used to break down in cellular respiration, what does it release ?
lawyer [7]

Answer:

Cellular respiration is the aerobic process by which living cells break down glucose molecules, release energy, and form molecules of ATP. Overall, this three-stage process involves glucose and oxygen reacting to form carbon dioxide and water.

3 0
2 years ago
The Y axis of a graph gives the units for the
igor_vitrenko [27]

Answer:

The y-axis of a graph gives the units for the dependent variable.

Explanation:

Dependent variable is the variable being tested and measured in an experiment, it depends on the independent variable.

7 0
3 years ago
How are the following arranged from smallest to largest: nucleoside, coil, supercool, chromosome, and DNA replication?
Andreas93 [3]
DNA Helix, DNA Supercoils, Nucleosome, Chromosome
Small < Large

8 0
3 years ago
Why do carbohydrates have to be broken down into glucose by the body?
Sladkaya [172]

Answer:

SIS lol

Explanation:

5 0
2 years ago
a guinea pig with hair (HH) is breed with a guinea pig without hair (hh) what would the phenotype of their offspring be?
iren [92.7K]

Answer:

<u>the genotype is (Hh)</u> <u>phenotype hybrid which is a Guinea pig with hair</u>.( hybrid means its not a pureblood haired Guinea pig. pureblood means same. EX: (GG). Guinea pig with hair. its also known as heterozygous, and zygous.)

witch also means  its heterozygous. there is no percentage chance for something to have a different genotype of phenotype.

6 0
2 years ago
Other questions:
  • What kind of cells are in only plants
    12·1 answer
  • Review the water cycle diagram below. What would be the effect on the mountains if the ocean were not nearby?
    9·1 answer
  • There is a new brand of water on the market that has been proven to relieve headaches. It is selling like crazy! When the Food a
    12·1 answer
  • Are offsprings such as Flatworms that a genetically identical to. The parent are produced by asexual or sexual reproduction?
    5·2 answers
  • I need help please someone answe
    11·2 answers
  • Pick a body function that requires at least two different organ systems to perform. The function can be involuntary or voluntary
    9·1 answer
  • GIVING BRAINLIEST!!!!!NO LINKS!
    9·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • HELPPP !!
    7·1 answer
  • Is a fly with no wings called a walk?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!