1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pachacha [2.7K]
3 years ago
12

Mrsa may be passed between wrestlers who compete against each other during a match. an individual who is exposed to this bacteri

a may become ill or even die. how would this bacterium be described
Biology
1 answer:
elena55 [62]3 years ago
3 0

MRSA is a kind of staph that can't be killed by antibiotics.

You might be interested in
Easy biology question below first correct answer gets brainliest
Anna11 [10]

Answer:

25%

Explanation:

5 0
3 years ago
I have an uno reverse card and I’m not afraid too use it >:D
anastassius [24]
Why am I slightly threatened by this?
3 0
3 years ago
<img src="https://tex.z-dn.net/?f=%5Csmall%5Cbold%5Ccolor%7Bviolet%7D%7BNeed%20%5C%3A%20help%20%5C%3A%20here%20%5C%3A%20plss%7D"
forsale [732]

Answer:

13 - D

14 - D

15 - C

Explanation:

for 13

A molecule is two or more atoms chemically combined

An example would be carbon dioxide which contains the two atoms, carbon and oxygen

Reasons its not the other answers:

Electrons, Protons and Neutrons are all parts of an atom therefore they cannot be classified as molecules.

For 14

Remember an atom is the most basic unit out of the units we are talking about

The answer would be D

Reasons its not the other answers

Water is considered to be a molecules as it contains two or more atoms (hydrogen and oxygen)

Air is considered to be a mixture as it contains oxygen and nitrogen which can be separated

Salt is considered to be a compound because salt is made up of two atoms (chloride and sodium) in which they are held up by an ionic bond

For 15

The answer would be C (III only)

Carbon hydrogen and oxygen all happen to by atoms

Reasons its not other answer choices:

Like stated previously water is considered to be a molecule therefore we can eliminate the other answer choices

Other notes:

Compounds and molecules both are combinations of two or more atoms however they are not to be mixed together

the main difference between compounds and molecules is how they are held together

Compounds are held together by ionic bonds while molecules are help up by covalent bonds

compounds and molecules  are made up of atoms that cannot be separated

Mixtures - A mix of two or more substances that can be separated

3 0
3 years ago
How many chambers does the human heart have?
Nesterboy [21]
The human heart has only 4 chambers. Left and right atria and left and right ventricles.
7 0
4 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • The division of the nucleus during the eukaryotic cell cycle is
    9·1 answer
  • Please Helppp!!! 100 points ASAP
    6·2 answers
  • How do scientists say the melting ice can contribute to disease occurrence? Also example
    14·1 answer
  • Directions: This group of questions consists of five lettered headings followed by a list of phrases or sentences. For each phra
    10·1 answer
  • What are the two sources of heat in the earth's interior?
    13·1 answer
  • Mitohondria is responisble for ?
    11·2 answers
  • You are looking through a microscope at onion cells and you see a cell with the sister chromatids lined up across the middle of
    6·2 answers
  • According to ohmz law which is stated as I = V ÷ R which two sentences are true ?​
    9·1 answer
  • All of these statements are incorrect EXCEPT: _______________
    9·1 answer
  • The condition in which an organism whose cells have either gained or lost a chromosome.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!