Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
soil compaction causes floods because rainfall water cannot infiltrate into the soil.
Explanation:
The use of heavy machinery in an area for urbanization and other purposes have always caused a series of problems to the top soil. One of the major consequence of such activity is the compaction of soil. Soil compaction is caused when stress is applied into the soil and the density of soil increases as a result.
It has been found that soil compaction causes floods because rainfall water cannot infiltrate into the soil due to the compact density of soil. The water instead ends up in the surface which subsequently causes floods.
The sun energy reaches earth through radiation.
Generating heat in order to start a reaction uses energy to begin with. Enzymes however reduce the activation energy and can only function (usually) within a narrow temperature range, using less energy. Enzymes are used because they are more efficient.
