All categories

3 years ago

Review the process outlined below. What will be the result if the replication process is followed as described?

Biology

2 answers:

V125BC [204]3 years ago

8 0

I'm sure C is a correct answer :) because question is about a result

n200080 [17]3 years ago

8 0

Answer:

The correct answer will be option C (Two new complementary strands of DNA will be built).

Explanation:

DNA replication is a process by which a cell makes exact copies (replicas) of its genetic material or DNA. DNA replication takes place during the S-phase or synthesis phase of the cell division.

DNA replication is complex process in which two strands of DNA are separated by an enzyme called helicase which melts hydrogen bond between two base pairs.Then, separated strand in 3'-5' direction polarity acts as a template strand or leading strand while 5'-3' direction acts as lagging strand.

New complimentary strands are formed by an enzyme called DNA polymerase which adds new nucleotides to the growing DNA chain by forming hydrogen bond between complimentary base pairs. Therfore, from ds-DNA molecule, two new complimentary strands are formed making exact copies of the DNA. This method is known as semi-conservative replication.

Hence, option C-two new complementary strands of DNA will be built is the correct answer.

You might be interested in

A gallon of Moo Milk costs $6.40. $ is the price, in dollars, of an 8-ounce glass of Moo Milk

alexandr1967 [171]

Answer:

1 gallon = 128 fluid ounces.

So to find the price of an 8 ounce glass of Moo Milk we need to multiply (8/128) x 5.12.

That equals $0.32.

Explanation:

5 0

2 years ago

Read 2 more answers

In a species of insect, wing length is determined by a single gene, for which there are only two alleles. in a population of 150

Phantasy [73]

I believe the answer is c. because of Darwin's theory of evolution..

3 0

3 years ago

Read 2 more answers

Our body temperature is usually kept near the normal value of 37 degrees C using homeostatic mechanisms. This temperature regula

zaharov [31]

<h2>Homeotherms Method</h2>

Explanation:

Homeotherms is right answer

Homothermy or homeothermy is thermoregulation that keeps up a stable inner internal heat level paying little mind to outside impact
This inside internal heat level is regularly, however not really, higher than the prompt condition
The encompassing temperatures increment, homeotherms utilize evaporative cooling through perspiring as well as gasping to control internal heat levels, and also vasodilate surface blood vessels to promote heat loss

7 0

3 years ago

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

Kazeer [188]

AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.

8 0

3 years ago

Read 2 more answers

Identify the phases of Meiosis II described below.

Annette [7]

1. The lining up of chromosomes by the spindle fibers takes place at metaphase II phase. It is the second stage of meiosis II, the spindle draws the chromosomes towards the metaphase plate.

2. The formation of the nuclear envelope around each set of DNA takes place in telophase II. Along with the formation of the nuclear envelope, the process of cytokinesis also takes place in telophase II, producing four daughter cells, each comprising a haploid set of chromosomes.

3. The sister chromatids are pulled apart in anaphase II stage. In this phase, the sister chromatids are migrated towards the opposite poles of the cell with the help of protein fibers.

4. The centromeres are moved towards the poles of the cell at prophase II stage.

8 0

3 years ago