1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LuckyWell [14K]
4 years ago
14

Help meee!! :( I need the answer ASAP

Biology
1 answer:
maw [93]4 years ago
8 0
Lady Bug A is a higher percentage because they are CAMOUFLAGED from predators. They SURVIVE and are able to reproduce. This TRAIT is passed on to the offsprings. This process is called NATURAL SELECTION
You might be interested in
Nervous System
ElenaW [278]

Answer:

sensory integration

Explanation:

Sensory information is processed in the brain in this step.

sensory - integration

integration :

the coordination of processes in the nervous system, including diverse sensory information and motor impulses.

which means processing

so sensory integration means

sensory processing

5 0
3 years ago
A pure-breeding fruit fly with curled wings mates with a pure-breeding fruit fly with normal (straight) wings. The F1 mate with
vesna_86 [32]

Answer:

The dominant curled wing allele is also a recessive lethal.

Explanation:

If we look at the F2 ratio we see that :  

curled wings: straight wings= 160:80

                                               =2:1

Hence,  if curled wings is considered to be a dominant trait then Curled wings * straight wings

Dd x dd

Punnet square will be as follows :

           d                    d

D   |    Dd   |        Dd

d    |    Dd   |        dd

Hence in order to get F2

Dd x dd

Punnet square will be the same as above if the F1 cross is Dd* Dd

        D    d

D DD Dd

d Dd dd

if DD is lethal then the ratio is

Dd:dd=2:1

that is curled wings: straight wings=2:1

Hence, The dominant curled wing allele is also a recessive lethal.

6 0
4 years ago
7. Why do molecules moving from high to low concentration need to use energy?​
zlopas [31]

Answer:

During active transport, substances move against the concentration gradient, from an area of low concentration to an area of high concentration. This process is “active” because it requires the use of energy (usually in the form of ATP).

Explanation:

4 0
3 years ago
The coarse and fine focus knobs adjust the distance between
Pavel [41]

The correct answer is: e. the stage and the objective lens.

Coarse Focus is the rough focus knob on the microscope used for the movement the of objective lenses toward or away from the specimen (located on the slice that is placed on the stage). On the other hand, fine focus is used to focus on various parts of the specimen.. Generally, coarse focus is used first to get close then moves to the fine focus knob for fine tuning.

3 0
3 years ago
Question 19 (2 points)
KiRa [710]

Answer:

they are needed for activation energy.

Explanation:

If they are needed for activation energy. Just like you don't say chloroplasts are a reactant in photosynthesis.

5 0
3 years ago
Other questions:
  • Which of these cities has the least change in seasons during the year
    6·1 answer
  • When does a fetus develop a nervous system?
    12·1 answer
  • Which statement correctly distinguishes between a closed circulatory system and an open circulatory system?
    7·1 answer
  • When insulin binds to its receptor, the complex is endocytosed into the cell. This is an example of ______ in response to hormon
    14·1 answer
  • 3.a group of tissues that work together to perform a similar function. A.cell B.organelle C. molecule D.organ
    14·2 answers
  • When you are ating celerey what tissues are you eating ?
    5·1 answer
  • 2. In Africa, Nile crocodiles can often be seen lying in the sun, their jaws held open. Small white egrets perch on the crocodil
    8·2 answers
  • About what percentage of the United States energy is supplied by nonrenewable resources?
    9·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • What items could you use to model a longitudinal and a transverse wave?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!