1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa [96]
3 years ago
12

What is one distinct DISADVANTAGE of sexual reproduction?

Biology
2 answers:
mina [271]3 years ago
6 0
The answer is C-<span> Sexual reproduction requires two individuals, which may be difficult for endangered or uncommon species of organisms.

Hope this helps.


</span>
nikklg [1K]3 years ago
5 0
I believe that C is your answer.
Hope this helps~!
~{Dunsforhands}
You might be interested in
Did you diagram all the faults and folds correctly? Which fault and/or fold did you find most difficult to diagram? Explain why.
Vikentia [17]

Answer:

nqjt qan

Explanation:

jbqan fm jbqfmn

7 0
4 years ago
Explain why life on land was difficult for early plants
kicyunya [14]
Because the soil didn't have the same nutrients it has now due to lack of decomposition of other plants and animals.
8 0
3 years ago
LOVE YOUR LIFE...because once you start to enjoy it... it will be too late
Elanso [62]

Answer:

Awww  ♡ 

Explanation:

Thank you

LOVE YOUR LIFE...because once you start to enjoy it... it will be too late

LIFE IS SHORT SO ALWAYS BE POSITIVE :)

love you! you deserve the best :) <33333 do the same

6 0
3 years ago
Read 2 more answers
Forensic Science Please Help!!
Crazy boy [7]

Answer:

The way they sound. like the way they type if that makes sense

8 0
3 years ago
Name 3 parts found in a plant cell that are also found in an animal cell.
nirvana33 [79]

Answer:Plant cells have plasmodesmata, a cell wall, a large central vacuole, chloroplasts, and plastids. Animal cells have lysosomes and centrosomes.

Explanation:The best answer

3 0
3 years ago
Other questions:
  • In temperate latitudes, surface winds tend to blow __________.
    12·1 answer
  • Give a scenario where a cell may need to preform a form of exocytosis
    10·2 answers
  • What is the correct procedure for students to follow if a chemical spilled
    14·1 answer
  • In a well-developed soil profile, which horizon is the uppermost layer?
    12·2 answers
  • What part of your brain controls your emotions
    12·1 answer
  • Excess vitamin a is most harmful to an embryo during the _____ months of pregnancy.
    7·1 answer
  • Gibbons are small apes that live in the trees of southeast Asia. A scientist predicts that at the current rate of deforestation
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which condition causes ocean water salinity to decrease?
    5·1 answer
  • Is there any specialized cells in a white rhino?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!