1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tcecarenko [31]
3 years ago
5

How does carbon enter and leave a humam being?​

Biology
2 answers:
ikadub [295]3 years ago
7 0

Answer:

"When humans burn fossil fuels to power factories, power plants, cars and trucks, most of the carbon quickly enters the atmosphere as carbon dioxide gas. ... Carbon moves from the atmosphere to the oceans. The oceans, and other bodies of water, absorb some carbon from the atmosphere. The carbon is dissolved into the water."

Explanation:

Contact [7]3 years ago
3 0
Through lungs, you breathe in o2 and co2 and your lungs naturally filtrate it into more co2 you can survive breathing in small amount of carbon but if consumption is at a high rate you will go to sleep and have hard headaches
You might be interested in
A cube with sides 4m in length has a volume of 64 m^3. If each side of the cube is doubled in length what is the ratio of the ne
aliina [53]

Answer:

the answer is A: 2:1

Explanation:

from,

the volume will be doubled

it will be

2 (64)/64

2:1

brainliest maybe???!!!

4 0
3 years ago
¿Cómo se le llama a los que pudieron dar origen a los seres vivos actuales?
natta225 [31]

Answer:

Una de las características de los seres vivos se encuentra en su composición biológica, dado que todos ellos están constituidos por cuatro bioelementos esenciales que se encuentran de manera abundante en la naturaleza:

Carbono

Hidrógeno

Oxígeno

Nitrógeno

Estos bioelementos o elementos biogénicos están presentes en las biomoléculas, que son las que dan forma a la materia que constituye a los seres vivos. Estas moléculas están formadas, a su vez, por la unión de átomos.

De estos bioelementos, es importante destacar el papel del hidrógeno y el oxígeno, que dan lugar a la molécula del agua. El agua, o H2O, juega un papel fundamental en el funcionamiento de los seres vivos.

6 0
3 years ago
Which unit of measurement is used to record the volume of 10 sunflower seeds?
Pavlova-9 [17]

Answer:

centimeters

Explanation:

i would really appreciete brainliest

7 0
3 years ago
Can anyone help me!?
ExtremeBDS [4]

Answer:

i believe its A because i studied this

Explanation:

4 0
3 years ago
Genetic drift is the process where there are random fluctuations in the gene frequencies within a population. Which of these pop
erma4kov [3.2K]

Answer:Genetic drift is the process where there are random fluctuations in the gene frequencies within a population. Which of these populations would most likely experience genetic drift?

Explanation:Genetic variation describes naturally occurring genetic differences among individuals of the same species. This variation permits flexibility and survival of a population in the face of changing environmental circumstances. Consequently, genetic variation is often considered an advantage, as it is a form of preparation for the unexpected. But how does genetic variation increase or decrease? And what effect do fluctuations in genetic variation have on populations over time?hen a population interbreeds, nonrandom mating can sometimes occur because one organism chooses to mate with another based on certain traits. In this case, individuals in the population make specific behavioral choices, and these choices shape the genetic combinations that appear in successive generations. When this happens, the mating patterns of that population are no longer random.

Nonrandom mating can occur in two forms, with different consequences. One form of nonrandom mating is inbreeding, which occurs when individuals with similar genotypes are more likely to mate with each other rather than with individuals with different genotypes. The second form of nonrandom mating is called outbreeding, wherein there is an increased probability that individuals with a particular genotype will mate with individuals of another particular genotype. Whereas inbreeding can lead to a reduction in genetic variation, outbreeding can lead to an increase.

5 0
4 years ago
Other questions:
  • Explain how some algal species are able to survive during periods of nutrient starvation and extreme temperatures. (Site 1)
    5·1 answer
  • Which of the following locations tend to experience more moderate climates (i.e., the temperature in these areas remain relative
    8·2 answers
  • Which organelle contains chlorophyll and is the location for photosynthesis? ribosome nucleus chloroplast endoplasmic reticulum
    8·1 answer
  • How does intestinal failure affect the body
    5·1 answer
  • When marking an animal for the mark/recapture technique, what can a scientist do to ensure the mark does not lower the organism’
    12·1 answer
  • Was there any water on Mars surface? Why or why not?
    12·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • How much liquid does this graduated cylinder contain? ✨
    6·2 answers
  • The table lists characteristics of a specific taxonomic classification. (the picture below)
    7·2 answers
  • The lungs of an animal, shown here, exchange gases with the environment to allow for oxygen to move in and carbon dioxide to mov
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!