1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr-060686 [28]
3 years ago
7

which of the following statements about scientific theories are true? (A) theories cannot be tested (B) theories are the same as

hypotheses. (C) theories can be used to predict the existence of as yet unobserved things or phenomena. (D) theories are ethical principles based on a religious foundation
Biology
1 answer:
Alekssandra [29.7K]3 years ago
7 0

(C)theories can be used to predict the existence of as of yet unobserved things or phenomena

You might be interested in
Exposure to environmental tobacco smoke (ets) causes approximately _______ nonsmokers to die of heart diseases annually.
Arte-miy333 [17]
Exposure to environmental tobacco smoke causes approximately 45 to 46,000 non smokers to die of heat diseases annually. Smoking harms the cardiovascular system in many ways which include; damaging the lining of arteries, reduces HDL, good choresterol, Raises LML, bad cholesterol, increases blood pressure and heart rate, it also causes the platelets to stick together in the blood stream and speeds the development of fatty deposits in the arteries among other risk factors. 
7 0
3 years ago
Help please!!!
nikdorinn [45]

it's b. anaphase and spindle fibres pulls chromosomes towards the centrioles in this phase.

7 0
3 years ago
Read 2 more answers
4.
enyata [817]
The answer is A 
hope this helps
8 0
3 years ago
Read 2 more answers
What are two important processes that occur during the prophase?
Sergio [31]

Answer:

In prophase, the nucleolus disappears and chromosomes condense and become visible. In prometaphase, kinetochores appear at the centromeres and mitotic spindle microtubules attach to kinetochores. In metaphase, chromosomes are lined up and each sister chromatid is attached to a spindle fiber.

Explanation:

7 0
3 years ago
Newton's first law of motion states that an object at rest, stays at rest, even if an
Natasha_Volkova [10]

Answer:

True

Explanation:

Newton’s First law of Motion states that an object in motion will stay in motion and an object at rest will stay at rest unless acted upon by an unbalanced force.

7 0
3 years ago
Read 2 more answers
Other questions:
  • A computer runs on a code that consists of only ones and zeros to carry information. How is this similar to DNA?
    5·1 answer
  • If someone who is trying to lose weight reduces their caloric intake by 800 kcal per day, and maintains the same calorie intake
    5·2 answers
  • Which of these sentences describes a benefit of fracking? A. Fracking provides jobs for people at well sites in the United State
    9·2 answers
  • Students are studying the rate of yeast fermentation under different conditions. Glucose is a monosaccharide. Sucrose is a disac
    11·2 answers
  • If given the following partner stand of DNA, what would be it's complementary strand?
    5·1 answer
  • Where is DNA located in your body?
    6·2 answers
  • How does cancer affect normal cell functioning?
    10·1 answer
  • 1234567891011121314151617181920
    8·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • An element has an atomic mass number of 16 and an atomic number of 7. How many protons and neutrons?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!