Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer: a change in energy state occurs. The answer is dark or opaque - not able to be seen through.
Explanation:
The absorption of light makes an object dark or opaque to the wavelengths or colors of the incoming wave: Wood is opaque to visible light. Some materials are opaque to some wavelengths of light, but transparent to others. Glass and water are opaque to ultraviolet light, but transparent to visible light.
The answer would be Nucleic Acids
Answer: Option B
The concentration of protein in the postglomerular blood is high comparef with arterial blood because as water passes into the capsule, the concentration of protein in the blood will increase.
Explanation:
Kidneys are bean shaped organs present in veterbrates and it is located in the retroperitoneal space. Kidney filtration involves where blood passes through the afferent arterioles and enters the glomerulus where blood that can be filter like nitrogenous waste and water moves towards the glomerulus and nonfilterable substances such as cells and serum albumins pass out through efferent arterioles. Thee concentration of protein increases from arterial to the post glomerular because some of the water molecules diffuses to the filtrate therefore, reducing water concentration. This lead to increase in concentration of protein because water is not available to diffuse the protein.
