1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Llana [10]
3 years ago
7

Which describes the role of carbon dioxide in photosynthesis?I will give brainliest!

Biology
1 answer:
castortr0y [4]3 years ago
8 0

Answer:

plants take in carbon dioxide during photosynthesis and release oxygen as a bi-product. the answer can also be that plants take in carbon dioxide during photosynthesis and absorb water through their leaves and roots

Hope this helps!!

You might be interested in
As successional changes occur in an ecosystem, new species take advantage of new conditions. where do these new species come fro
Bumek [7]
The new species come from old ancestors of the animals that were there, over time they slowly evolved, and they adapted to that new environment.
6 0
3 years ago
Schizogony is an important aspect of which of the following diseases?A. Chagas diseaseB. schistosomiasisC. toxoplasmosisD. plagu
Gwar [14]

Answer:

E. Malaria

Explanation:

Schizogony refers to the process of asexual reproduction through the process of multiple fission. The malaria parasite, <em>Plasmodium</em> species, enters the human body through the bite of female anopheles mosquitoes.

These mosquitoes carry haploid sporozoites in their saliva which are released into the bloodstream of human. The haploid sporozoites enter the liver cells where they multiply and increase their number through the process of multiple fission.

The process of schizogony in sporozoites of malaria parasite produces merozoites which are then released from the liver cells.

8 0
3 years ago
Read 2 more answers
Explain ur own answer. <br>need​
Pepsi [2]

Answer:run over with ice to make sure hes okay

Explanation:

6 0
3 years ago
Choose the statement that accurately describes the relationship between cytokinesis and mitosis.
mart [117]
The correct sequence of events that occur during the cell growth and reproductive process or cell cycle would involve that cytokinesis which involves splitting or separating of the cytoplasmic media connecting the cells together to produce 2 new cells that have the same genetic content, occurs after Mitosis.

The correct response would be C. Cytokinesis follows mitosis.
7 0
3 years ago
Read 2 more answers
The cartilage which divides the nose in two parts is called the
VARVARA [1.3K]
The cartilage of septum!!!
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which organism does this data suggest is most closely related to organism a?
    14·1 answer
  • Which of these best explains why a molecule of ATP is needed for this type of transport?
    10·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The upper forelimbs of humans and bats have fairly similar skeletal structures. T/F
    7·1 answer
  • Animal wastes that runoff into water is an example of which types of pollution? question 3 options: bacterial &amp; chemical nut
    10·1 answer
  • DOES ANYONE KNOW HOW TO SOLVE THIS??
    15·2 answers
  • How are tropical rain forests and temperate forests different?
    12·1 answer
  • 3. Which of the following is an example of an artificial concept?
    8·1 answer
  • The TSW (Tsunami Warning System) is located in the Pacific Ocean and 26 different
    12·1 answer
  • After the transfer of electrons, calcium becomes an ion with a charge of Fill in the blank text field 5
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!