1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faust18 [17]
3 years ago
15

What type of plate boundary is illustrated in Figure 9-1?

Biology
1 answer:
sashaice [31]3 years ago
6 0

Answer:This type of plate is Convergent plate boundary.

Explanation:from this figure we can see that two  plates meet together and one of this  plates go under the other  plate and this represent the convergent plate boundary.

You might be interested in
- 20 еу<br>What is the anatomy ?<br>​
Sergio039 [100]

Answer:

The study of internal structures is called anatomy forexample to study the internal structure of heart

Explanation:

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What is a spring tide abs would a spring tide occur
Harrizon [31]
They are very very strong tides they have nothing to do with the season spring they occur when the sun moon and Earth are in a line., the gravitational forces of the Moon and the Sun both contribute to the Tides. spring tides occur during a new moon or full moon
7 0
3 years ago
A benign tumor differs from a malignant tumor in that a benign tumor
ale4655 [162]

Your answer is...

<em>A benign tumor is a noncancerous group of cells that does not spread any harmful substances to the impacted area nor anything at all. It is safe compared to Malignant tumors and typically cause no harm to the body.</em>

<em />

Benign tumor:

Although it is noncancerous, if it is applying pressure to any vitals such as the blood vessels or nerves, it causes an obstruction. Thus ending up having to require treatment occasionally but not in all cases. It is considered a "good" tumor since it does not cause any pain or any problems when it doesn't apply pressure.

Malignant Tumor:

A Malignant Tumor is known as cancerous, or just cancer. These can be spread around the affected area of tissue or throughout the body. It is uncontrollably spread and disease ridden tumor that destroy the body tissue of the person. If this moves into the bloodstream, it can lead up to spreading within the lymph nodes, causing even more damage.

7 0
3 years ago
6. The arrow represents the movement of which substances?
stealth61 [152]

Answer:

wet

Explanation:

8 0
3 years ago
Other questions:
  • Which level has the most biomas? <br> (Ecological pyramid)
    6·1 answer
  • What is the group number of the most nonmetallic group that contains metalloids?
    5·1 answer
  • Producers are the most important biotic factor in an ecosystem<br><br>true or false?
    6·1 answer
  • Suppose an animal is heterozygous AaBb, and the traits are not linked. When meiosis occurs, what is the total number of possible
    11·1 answer
  • What happens when an environment has not reached its carrying capacity for a population
    9·2 answers
  • Identify the type of cellular receptor shown in the image above. Please help me
    9·2 answers
  • Hox genes are sometimes called "master switches". They have acquired this nickname because a single Hox gene will turn on (or of
    9·1 answer
  • Food web stability is most dependent on _____.
    10·1 answer
  • What is not a method for disposing of hazardous wastes?
    11·1 answer
  • Amphipathic phospholipids arrange themselves into a(n) ______ to form the plasma membrane multiple choice question.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!