1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serhud [2]
4 years ago
13

Describe the connection between fossil fuel burning, the melting of polar ice, and the rising of global sea levels.

Biology
1 answer:
padilas [110]4 years ago
3 0
Burning fossil fuels will produce carbon dioxide which is a global gas causing global warming . Global warming causes the sunlight to be trapped in the atmosphere of the earth which will cause the temperature of the earth to increase. so the polar ice will melt and the sea level will increase
You might be interested in
Carbon compound that stores and transmits genetic information is called
torisob [31]

Answer:

Deoxyribonucleic acid (DNA) 

4 0
4 years ago
Who reviews articles for peer-reviewed journals
Fofino [41]
The answer to this question is:

Who reviews articles for peer-reviewed journals"Peer-reviewed journals are experts that write articles and when other experts review the same thing to make sure it has the best quality"

Hoped This Helped, <span> Johnbryant596
Your Welcome :) </span>
3 0
3 years ago
Which of the strands use a template for dna replication? question 2 choices choice
Katena32 [7]
The answer is letter C

hope this helps if not just let me know
4 0
3 years ago
Had you been Louis Pasteur what would have been your reflections and conclusions based on the broth &amp; left open flask experi
bazaltina [42]
Based on the broth left on an open flask experiment, wherein the boiled broth was placed in two flasks (one flask with straight neck and the other flask has a bent neck) and exposed to open air at room temperature for several weeks.

The broth within the straight neck flask has changed its appearance. It became discolored and cloudy. Whereas, the broth in the bent neck open flask still remains the same.

These results would then support the conclusion that germs in the air were able to fall unobstructed towards the straight neck flask and contaminate its contents. While, the bent neck of the 2nd open flask acted as a trap for the germs, preventing the germs from contaminating the broth. Further emphasizing that germs can only come from other germs and not from spontaneous generation.
6 0
4 years ago
Read 2 more answers
Describe the movement of ions that causes an action potential to occur.
AveGali [126]
Okay well the signal or the movement coming through the neuron(and its axon)  is about the ions. The ion is a charged like particle, such as Na+ (If you remember that). Na+ is a sodium ion. So most of those ions I was talking about before just simply flow in or out of the cell. I hope this helps! <3
3 0
3 years ago
Read 2 more answers
Other questions:
  • You classified organisms based on anatomical structure and development. Scientists also use DNA to classify organisms. Consideri
    7·1 answer
  • What is the general function of the nucleus?
    14·1 answer
  • 3. Which of these organs is directly involved in
    9·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • 18. Which of the following is an appropriate prediction of how the introduction of the new bacteriophage will affect the nitroge
    15·2 answers
  • What happens to the food supply when food prices are high?
    7·1 answer
  • 1. Which of the following is NOT a true property of water? * 1 point
    10·1 answer
  • Drosophila melanogaster (select all that apply): Group of answer choices Have the significant disadvantage of a multiple-month l
    12·1 answer
  • Deciduous trees, such as maple and elm trees, regularly drop their leaves in a response to a change in the environment.
    7·1 answer
  • PLSSS HELP IF I GET IT RIGHT 30 POINTS FOR BRAINLIEST!!!​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!