1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
polet [3.4K]
4 years ago
5

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGC

CTAGTAGCCTTC(3). What is RNA sequence copied from this sequence?
Biology
1 answer:
Verizon [17]4 years ago
4 0

Answer:

Explanation:

In the DNA, the nitrogen bases, Adenine A (a purine) forms double bond with Thymine T (a pyrimidine) but in RNA, the bond is with Uracil U (a pyrimidine) instead of Thymine; Guanine G (a purine) forms triple bond with Cytosine C (a pyrimidine): this also occur in RNA. This we have:

DNA sequence: 5' ATGCGTAGCCTAGCCTAGTAGCCTTC 3'

Complimentary strand : 3' TACGCATCGGATCGGATCATCGGAAG 5'

The RNA sequence is produced running from the 5' to the 3' direction thus, the complimentary strange will be used.

5'AUGCGUAGCCUAGCCUAGUAGCCUUC 3'

You might be interested in
How is the water in hydrothermal vents heated
sergij07 [2.7K]
The particles are predominantly very fine-grained sulfide minerals formed when the hot hydrothermal<span>fluids mix with near-freezing seawater. ... The cold seawater is </span>heated<span> by </span>hot<span> magma and reemerges to form the </span>vents<span>. Seawater in </span>hydrothermal vents<span> may reach temperatures of over 700° Fahrenheit </span>
4 0
3 years ago
Read 2 more answers
What is an advantage of asexual reproduction?
brilliants [131]
Either D or A.. Not so sure though
8 0
3 years ago
Explain they transitional fossils provide powerful evidence for common descent
Soloha48 [4]

Answer:

Fossils are important evidence for evolution because they show that life on earth was once different from life found on earth today. ... Paleontologists can determine the age of fossils using methods like radiometric dating and categorize them to determine the evolutionary relationships between organisms.

Explanation:

5 0
3 years ago
Andrew is trying to identify an unknown element. The element is dull and
PilotLPTM [1.2K]

Answer:

non metals

Explanation:

4 0
3 years ago
Friction is a force exerted in the direction opposite to an object's motion, which means friction will cause an object's
Elden [556K]

Answer:

true

Explanation:

think of a box, if you push it on a smooth floor without friction it would glide pretty easy

but put it on say carpet, the friction from the carpet would not allow the box to move very far

that's also how brakes work, they apply friction to the wheels in order to get them to reduce motion

4 0
3 years ago
Other questions:
  • What is it called when bacteria take in DNA from their environment?
    7·1 answer
  • Name one of the pupillary reflexes you will be examining today. __________ reflex
    12·1 answer
  • "_____ is an unpleasant side effect that alcohol withdrawal creates for an alcoholic."
    12·2 answers
  • Why do some cells have nothing inside of them
    5·1 answer
  • Replacement of damaged and worn-out cells in an organism can happen as a result of ?
    12·2 answers
  • One parent has a dominant gene for a
    12·1 answer
  • Amanda is a three-year-old who has a condition that is characterized by the inability of her pancreas to produce cholecystokinin
    8·1 answer
  • What is the element that has similar reactivity to Phosphorus but less mass
    13·1 answer
  • Trying to explain a solar eclipse is an example of
    12·2 answers
  • How do poriferans and earthworms differ in their mobility? how might mobility have influenced their modes of reproduction?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!