1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
7

Water molecules form hydrogen bonds to help in the process of water transport. Which property of water is described?

Biology
1 answer:
elixir [45]3 years ago
3 0
The property of water which is being described is definitely c) cohesion, according to the fact that cohesion is always sticking to self material. This characteristics coincides with the data given above. I think you'll find it helpful. 
You might be interested in
The epigastric region is a portion of the cavity. multiple choice pelvic pleural vertebral abdominal
svetlana [45]

The epigastric region is a portion of the <u>abdominal </u>cavity.

The correct option is d.

The greatest hollow area in the body is the abdominal cavity. Its lower limit is the upper plane of the pelvic cavity, and its upper barrier is the diaphragm, a sheet of muscle and connective tissue that divides it from the chest cavity. The spinal column, as well as the abdomen and other muscles, encircle it vertically.

The epigastrium is the top portion of your abdomen that is immediately below your rib cage. The epigastrium houses your pancreas and the duodenum, a section of your small intestine. Additionally, your stomach and liver are partially located here.

To learn more about epigastric region, refer

brainly.com/question/28237650

#SPJ4

6 0
2 years ago
a light weight material is being tested effectiveness in blocking ultraviolet rays from the sun that cause skin to burn and poss
Lynna [10]
Exposing it to <span>ultraviolet rays and seeing the efectiveness</span>
3 0
3 years ago
Read 2 more answers
Species adapt over time through structural and behavioral adaptations.
Anarel [89]
C. Protective over young cubs

8 0
3 years ago
Read 2 more answers
How is the earthworm beneficial to the formation of soil?
dedylja [7]
By their activity in the soul
5 0
3 years ago
Read 2 more answers
BRAINLIESTTT ASAP!!<br><br> please answer :)
Kryger [21]
Part 1: 
The carbon-monoxide, carbon-dioxide, and other harmful gasses are being released into the environment by the factory causing the air to be polluted.

Part 2:
The factory is putting in mechanical work, so the energy coming out is mechanical energy which is being transformed into chemical energy in the form of harmful gases.

Part 3:
This process is a recycling of carbon in the carbon cycle because along with adding carbon-dioxide to the air, it also provides photosynthetic autotrophs with carbon-dioxide which is required for photosynthesis. This will then be turned into oxygen which is used for cellular respiration in animals.
3 0
3 years ago
Other questions:
  • I will.mark.brainliest
    9·2 answers
  • With advancing age, __________ become less responsive to antigens. Additionally, __________ are less responsive, and antibody le
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • ______________ takes place when heat is transferred from one substance to another by direct contact. For example, imagine that y
    9·1 answer
  • The function of the sinoatrial node is to
    11·1 answer
  • The kinetochore is a structure that functions to a. connect the centromere to microtubules. b. connect centrioles to microtubule
    12·2 answers
  • Sickling occurs in deoxyhemoglobin S but not in oxyhemoglobin S. Oxyhemoglobin has a small, hydrophobic pocket in a β chain regi
    9·1 answer
  • One reason tundra plants are small and grow close to the ground is that _____. a.)animals eat them before they can grow
    10·2 answers
  • 6. Which of the following cells undergo meiosis?
    12·1 answer
  • Please help me! Major grade. Tysm!!
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!