1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
malfutka [58]
3 years ago
7

What would most likely happen if a person increased the amount of saturated fat in his or her diet? The person's risk of cardiov

ascular disease would increase. The person's risk of cardiovascular disease would decrease. The person's bad cholesterol would decrease. The person’s good cholesterol would increase.
Biology
2 answers:
Feliz [49]3 years ago
8 0
The risk of cardiovascular disease will increase. as well as bad cholesterol.
kirill115 [55]3 years ago
7 0

Answer:

The person's risk of cardiovascular disease would increase.

Explanation:

The consumption of foods with saturated fats and of animal origin is associated with an increased risk of cardiovascular disease.

Saturated fat is the main dietary factor that increases blood cholesterol the most, especially LDL cholesterol. However, trans fats are the most dangerous in increasing cardiovascular risk.

You might be interested in
What areas of the brain does the zombie virus affect?
makkiz [27]
There is no virus that currently exists that would be considered the zombie virus. However rabies is an exceptionally close one, so comparisons can be drawn. The zombie virus would most likely require a host to remain alive so allot he important functions such as the ones that allow breathing or cardiac activity will have to remain. However the virus would most likely attack the areas of the brain mostly in regards to the areas controlling judgement, perception, anger, impulse control, and appetite.
4 0
3 years ago
Waste products are also removed by the skin.
andrey2020 [161]

l think it is false ☺️

8 0
3 years ago
Someone pls answer thissssssssssssssssssssss
KengaRu [80]

Answer:

See explanation

Explanation:

We know that the momentum of a body is defined as the product of mass and velocity of the body.

Let us now obtain the momentum for each item on the list;

Football player = 100 * 10 = 1000 Kgms-1

Skier = 60 * 20 = 1200 Kgms-1

Frog = 0.9 * 12 =10.8 Kgms-1

Meteorite = 0.1 * 1000 = 100Kgms-1

Base ball = 0.14 * 30 = 4.2 Kgms-1

Satellite = 3000 * 8000 = 24000000 Kgms-1

Steel ball = 2.0 * 2.8 = 5.6 Kgms-1

3 0
3 years ago
Other than sunlight for energy, photosynthesis in plants need these two things that we breathe out. What are they ?
jenyasd209 [6]

Answer:

CO2 and water (H2O)

Explanation:

4 0
3 years ago
Read 2 more answers
Which of the following is a major cause of liver cirrhosis?
marishachu [46]

Answer:

b. Infection with a hepatitis virus

Explanation:

The infection with hepatitis virus can cause sever tissue damage that leads to permanent scarring.

8 0
4 years ago
Other questions:
  • A train travels 50 km/h south for 2 hours. Then the train
    10·1 answer
  • How does the cell regulate the substrate specificity of ribonucleotide reductase to maintain equal amounts of all four deoxynucl
    8·1 answer
  • R = red flowers r = white flowers According to Mendel’s law of dominance, which statement best describes the result of a cross b
    14·2 answers
  • Can y’all help with this please ( the whole page)
    6·1 answer
  • Which of these elements is a noble gas? A. hydrogen (H) B. barium (Ba) C. nitrogen (N) D. krypton (Kr) E. bromine (B
    13·1 answer
  • Brent has been diagnosed with terminal cancer. today, he spent hours praying: "please, i'll do anything. just give me one more c
    11·1 answer
  • Mrs. Winters wants to know why A1C test is being done and what it will show. What should Sarah tell her?
    14·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • The image below shows plant cells.
    12·1 answer
  • A car travels 10 km in 15 minutes. What is the average speed of the car?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!