1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
11

Can you please help me with this BCR i need like 4-5 sentences, THANKS

Biology
1 answer:
Tasya [4]3 years ago
6 0
A BCR is a ratio of the benefits of a project proposal expressed in monetary terms relatives to its costs also expressed in monetary terms all benefits and costs should be expressed in discounted present values. that's all I can think of I'm sorry if it didn't help

You might be interested in
One characteristic of Fungi is that they have a cell wall made of chitin. What are two other characteristics of Fungi?
IrinaK [193]
I just took this quiz yesterday and I found many examples of the characteristics of fungi. Here are two that I didn't use because I wouldn't want you to get in trouble for plagiarism or anything ; )

<span>1.) Every fungi contains mass of interwoven hyphae is called mycelium.
2.)They have reserved food material in the form of glycogen or oil-droplets </span>

6 0
3 years ago
Read 2 more answers
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
An adaptation is _____. see concept 22.2 (page 469) view available hint(s) an adaptation is _____. see concept 22.2 (page 469) a
beks73 [17]

Answer:

A trait that gives an organism a reproductive advantage in the current environment

Explanation:

  • Adaptations are mutations that helps an organism, such as animals or plants to survive in its environment due to a reproductive advantage.
  • Adaptations may be structural or behavioral adaptations. Structural adaptations are features or the physical part of an organism that boosts its survival.  Behavioral adaptations on the other hand, are responses made by an organism to help it survive or reproduce.
4 0
4 years ago
Need help can somebody help me please and thank you
Slav-nsk [51]

Answer:

ok think of apples and trees and car and garage

Explanation:

the A goes to the T because it represents apples to trees and then C goes to the G because its car to the garage it that's how i've always remembered that for MRNA

4 0
3 years ago
Read 2 more answers
In the arctic energy pyramid, which trophia laval has the least amount of energy available to it?
ikadub [295]

Answer:

tertiary consumers

Explanation:

6 0
3 years ago
Other questions:
  • At low concentrations, alcohol can have a stimulant type effect. as the bac rises above .06, the drinker may begin to experience
    10·1 answer
  • How is natural selection related to sexual reproduction as opposed to asexual reproduction?
    12·2 answers
  • Rachel Carson can be credited for _______. a. the modern environmental movement, slowing the extinction rate of hibernating mamm
    11·1 answer
  • Which student, if either, is most correct in their claim regarding the ATP/ADP cycle?
    12·1 answer
  • Igneous rocks are made from?
    11·2 answers
  • Describe how energy and matter flow, interact and change forms throughout the<br> Earth system
    7·2 answers
  • What do cars, power plants and furnaces have in common
    9·2 answers
  • Some conifers lose their needles seasonally, just as deciduous trees do.<br> True<br> False
    7·2 answers
  • Question 1 (2 points)
    12·2 answers
  • Which stage of the cell cycle is matched with the proper event?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!