1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
3 years ago
11

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C

Biology
1 answer:
topjm [15]3 years ago
3 0

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

You might be interested in
Wildflowers bloom earlier than large trees. This helps wildflowers compete for _____.
Pavlova-9 [17]

It is D

:D =-O :-P ;-) :-( :-) :-! :-$ B-) :O :-* :-D :'( :-\ O:-) :-[

7 0
3 years ago
Read 2 more answers
What assumption can be made if a twin-study design project reveals that the correlation between identical twins on a given trait
Diano4ka-milaya [45]

Answer:

Several assumptions can be made using these results. The one of the main assumption is that these result prove the higher similarity among identical twins then of those who are fraternal. This is because the identical twins share mostly same amount of genome from both parents as a single zygote that is fertilized by one sperm divides into two. On the other hand, all fraternal are dizygotic. It means that there were two eggs that were fertilized by two totally different sperms. They do not share any of characteristics but may share some with parents.  

7 0
3 years ago
Kathy used a survey to determine how many of her classmates were left-handed and how many were right-handed.
padilas [110]
C. Test the hypothesis with an experiment because her survey was an experiment to prove/disprove her hypothesis
6 0
3 years ago
What do the iron-sulfide hypothesis and the lipid membrane hypothesis have in common?
AnnyKZ [126]
The formation of the first cells is common in both hypotheses.
3 0
4 years ago
Read 2 more answers
Body systems work together to maintain homeostasis of the organism. However, different body systems perform different functions.
aliya0001 [1]

Answer:

A) respiratory system: gas exchange

Explanation:

The respiratory system's main  function is to supply oxygen to all the parts of your body. It accomplishes this through breathing: inhaling oxygen-rich air and exhaling air filled with carbon dioxide, which is a waste gas

3 0
3 years ago
Read 2 more answers
Other questions:
  • Chemical equilibrium results if _____.
    8·2 answers
  • Key Concept Check Why is Earth warmer at the equator and<br> colder at the poles?
    13·2 answers
  • Which cells are a product of meiosis? A.blood cells
    9·2 answers
  • In a population that is in Hardy-Weinberg equilibrium, there are two possible alleles for a certain gene, A and a. If the freque
    9·1 answer
  • Which stamens correctly describe the rock cycle
    13·2 answers
  • Which of the following is not a sedimentary structure?
    15·1 answer
  • A oceanic to continental convergence boundary would produce what type of volcano?
    6·1 answer
  • Which of the following reasons for studying botany is most directly related to increased profits?
    11·1 answer
  • Describe what happens in the two phases of aerobic respiration?<br>​
    11·1 answer
  • describe the difference between high soil water potential and low soil water potential. which is better for a thirsty plant root
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!