1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Angelina_Jolie [31]
3 years ago
7

HELP!!! How does the Galápagos penguin compare to the cold adapted emperor penguin of Antarctica?

Biology
1 answer:
skad [1K]3 years ago
7 0
<h3><u>Comparison between Galapagos penguin and cold adapted Emperor penguin of Antarctica:</u></h3>

<u>Galapagos penguin:</u>

  • Galapagos penguins are the only species of penguins that live north of the Equator.
  • The Galapagos penguins breed all-round the year.
  • The Galapagos penguins are smaller compared to the cold-adapted emperor penguins of Antarctica.
  • The breeding and nesting place of the Galapagos penguins lie on the shoreline.

<u>Emperor penguin:</u>

  • The emperor penguins live and adapt to the cold Antarctic environment.
  • The Emperor penguins breed only during the Antarctic winters.  
  • The nesting of emperor penguins is on ice cliffs and icebergs where the eggs are protected from the strong and cold Antarctic winds.
  • However, both of these species of penguins are at risk of extinction due to the rise in temperature and shortage of foods.
You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
2 years ago
The phrase that best describes the translation from the graph y = (x – 5)2 + 7 to the graph of y = (x + 1)2 – 2.
Alekssandra [29.7K]
The phrase that best describes the translation is: 6 units right and 9 units down. The answer to your question is B. I hope this is the answer that you are looking for and it comes to your help.
6 0
3 years ago
A fiddlehead develops into what plant part?
Vlad1618 [11]

Answer: Fiddleheads or fiddlehead greens are the furled fronds of a young fern, harvested for use as a vegetable. Left on the plant, each fiddlehead would unroll into a new frond (circinate vernation)

Hope this helped and consider brainleist

:D

6 0
3 years ago
Label parts A and B in this picture of saprophytes (fungi)
gayaneshka [121]

Answer: A- Sporangium

              B- Rhizoids

Explanation:

7 0
3 years ago
What gases are being exchange in the alveoli
Shkiper50 [21]
Oxygen and Carbon Dioxide are the two gases being exchanged in the alveoli. Carbon Dioxide diffuses blood into the air, and oxygen diffuses from the air in the alveoli into the blood.
7 0
3 years ago
Other questions:
  • persenyawaan dan perbedaan apakah yang ada antara proses perbuatan roti dan proses pembuatan bir ? jelaskan!
    13·1 answer
  • A genetic form of "night blindness" (i.e. poor vision in dim light) is caused by mutations in genes encoding rhodopsin kinase (R
    12·1 answer
  • One type of natural selection is balancing selection. One scenario that can lead to balancing selection is when a heterozygote p
    7·1 answer
  • What is a sharks' skin made of?
    14·1 answer
  • What happens in meiosis during telophase Il?
    9·1 answer
  • HELP.. _____ immunity occurs when a person's immune system responds to an<br> antigen.
    11·1 answer
  • Please can anyone help me ill make you the brainiest, I need help with these questions!
    15·1 answer
  • Post malone is the best
    14·2 answers
  • Two different elodea leaves were placed in solutions. Solution A used tap water (1% salt and 99% water) while Solution B used sa
    5·2 answers
  • The introduction of invasive species to an ecosystem can change the dynamic of the
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!