1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alekssr [168]
3 years ago
5

A common inhabitant of human intestines is the bacterium Escherichia coli. A cell of this bacterium in a nutrient-broth medium d

ivides into two cells every 20 minutes. The initial population of a culture is 63 cells.
Find the rate of growth after 8 hours. (Round your answer to three decimal places.) ...?
Biology
1 answer:
Anastaziya [24]3 years ago
4 0
This is an example of exponential growth, determined an equation of the form P=Po*e^(kt), where Po is the initial value, P the value at time t. 


<span>You can find the value of k, the relative growth rate, by substituting in the above equation. All the other questions are a matter of arithmetic.


Just plug-in the given values and you can now solve this problem yourself!</span>
You might be interested in
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
12. The fish that invaded the Great Lakes and devastated trout populations are
irina1246 [14]
That would be the Sea Lampreys

A.Lampreys
6 0
4 years ago
Read each example and decide whether each would increase or decrease the genetic variation in the gene pool of that population.
klemol [59]

The measure of variation which exists in the genetic makeup of any particular individual within a population is genetic variation. There are several key features and advantages associated with the genetic variation as it is an important factor causing evolution allowing natural selection thus leading to increase or decrease the frequency of alleles in a population.

The other factors causing genetic variation include random mating, mutation, random fertilization and recombination during meiosis between the homologous chromosomes.

The main advantage of genetic variation is it enables the individuals to adapt to environment as well as maintaining the survival of the population.

Based on the information on genetic variation we can conclude whether there is increase or decrease in the genetic variation of the population in the gene pool.

• A zebra migrates to join a different herd of zebras- Increase

• Competition for sunlight leads to taller trees- Decrease

• The DNA of a snake changes to make its venom stronger- Increase

• A grass-fire randomly sweeps through a population of buffalo and kills most of the animals- Decrease

6 0
3 years ago
Read 2 more answers
When do the divers have the most kinetic energy?
KiRa [710]

Answer:

A diver on a diving board has kinetic energy equaling zero, but potential energy proportional to the distance between the board and the water. If When the diver dives leaves the platform, he begins losing potential energy because he's nearing the water.

8 0
3 years ago
When Europeans arrived, the white and red pine that grew near the jack pine plains, were logged and then all the pine acreage wa
kari74 [83]

Answer:

Deforestation negatively impacts the <u>carbon cycle</u> as <u>trees</u> play an important role in <u>balancing the amount of carbon in the atmosphere</u>.

Explanation:

Deforestation is one of the most damaging activities to the environment due to different reasons but mainly because it releases important amounts of carbon dioxide to the atmosphere due to the logging and burning of forests and also leads to the reduction of fauna populations because of habitat destruction.

In this case, cutting white and red pines and then setting a pine acreage on fire disrupts the carbon cycle because:

a) [As stated above] <u>Trees play an important role in balancing the amount of carbon dioxide (CO2) in the atmosphere</u><u> as there is less photosynthesis carried out by plants - important part of the carbon cycle.</u>

b) <u>When </u><u>trees (wood) are burned, the carbon that was formerly stored is released into the atmosphere as CO2,</u> leading to another disruption in the carbon cycle.

5 0
3 years ago
Other questions:
  • A sand storage tank used by the highway department for winter storms is leaking. As the sand leaks out, it forms a conical pile.
    15·1 answer
  • Your patient is a​ 29-year-old man who works in a​ meat-processing plant. he received a knife wound in the proximal anteromedial
    7·1 answer
  • Stress has an effect on every system of the body. Please select the best answer from the choices provided. T F
    8·1 answer
  • Which is not a true statement about goals? Choose all that apply.
    7·2 answers
  • The cichlid Cynotilapia afra, introduced at West Thumbi Island in Lake Malawi in the 1960s, has split into two genetically disti
    9·1 answer
  • What is Potometer?????
    15·1 answer
  • Which two organisms in the food web would MOST LIKELY be affected by a decrease in producers, or the plants, at the bottom base
    10·1 answer
  • Which are characteristics of scientific questions? Check all that apply.
    11·1 answer
  • How do you think the study of life can help you to understand yourself?<br><br> Some opinions
    7·1 answer
  • Which one of the following is the correct answer ?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!