1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
3 years ago
13

En coding the phrase " ruptured aneurysm of carotid artery, extracranial portion," the main term to reference in the index is __

___.
Biology
1 answer:
gogolik [260]3 years ago
3 0

The main term of reference in the index is  Aneurysm

Extra cranial carotid artery aneurysms ruptures when the blood clots are formed in them.  The term  aneurysms is a disease  that is happening due to the weakness in the wall of artery. The weakened arteries widens out or swells.

You might be interested in
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Cell cycle regulators are:
sweet-ann [11.9K]

Answer:

If this didn't help then vote me 1 star. Thanks.

Explanation:

Two groups of proteins, called cyclins and cyclin-dependent kinases (Cdks), are responsible for the progress of the cell the. A phosphatase is an enzyme that removes a phosphate group from a protein. Together, these two families of enzymes act to modulate the activities of the proteins in a cell, often in response to external stimuli. Rough the various checkpoints. What genes destroy cancerous cells?  The primary function of the p53 gene is to repair or destroy defective cells, thereby controlling potential cancerous cells. This type of gene is called an anti-oncogene or tumor suppressor gene Cancer growth blockers are also called cancer growth inhibitors. They are a type of targeted cancer drug.  Our body makes chemicals called growth factors that control cell growth. Cancer growth blockers work by blocking the growth factors that trigger cancer cells to divide and grow. There are many types of cancer growth blockers that work in different ways..

6 0
2 years ago
Who help me?, this has me crazy
denis23 [38]
It’s D, other answers don’t make sense
4 0
3 years ago
What two actions are required to work together to move water to the top of tall plants
LenKa [72]
A tectonic plate boundary always forms when two continental plates collide. Neither plate sub ducts because the crust have approximately the same density. Instead, the rocks are smashed together causing them to recrystallize due to the intense heat and pressure from the colliding plates.
3 0
3 years ago
A hurricane can form when a large air mass develops over a tropical ocean and causes rising air to move in a circular motion. Wh
Mamont248 [21]
It’s definitely D. Warm and humid
3 0
3 years ago
Other questions:
  • What is true of an atom's nucleus?
    5·1 answer
  • Does Clorox kill cockroach
    10·2 answers
  • What is shown in the image?
    9·2 answers
  • Why is the earth's inner core solid?
    12·1 answer
  • What can you infer about fossil fuels from their name?
    8·1 answer
  • Which word correctly fills both blanks in the description below?
    9·1 answer
  • What are the resources of the ocean
    15·1 answer
  • Select the correct answer. Which statement about natural selection is true? A. Natural selection and evolution are two terms for
    15·1 answer
  • Part B If different masses of water are heated to the same temperature, which sample will absorb more energy? Base your argument
    13·1 answer
  • Which best describes oxidation-reduction reactions?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!