1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Norma-Jean [14]
3 years ago
8

Which of the following is least important when considering lab safety?

Biology
1 answer:
Alona [7]3 years ago
5 0
C because it really doesn’t matter if you wash your hands before because it is recommended to wash them after to prevent any infections or diseases
You might be interested in
Could someone please answer this question?
77julia77 [94]

Answer: Genes are segments of deoxyribonucleic acid (DNA) that contain the code for a specific protein that functions in one or more types of cells in the body. Chromosomes are structures within cells that contain a person's genes. Genes are contained in chromosomes, which are in the cell nucleus.

Explanation:

7 0
3 years ago
Read 2 more answers
5. Which of the following does NOT correctly match a fault with its boundary? *
serg [7]
C does not correctly match
8 0
3 years ago
A model that helps explain the results of mendels crosses is called a?
otez555 [7]
It is called a Punnett Square
7 0
3 years ago
Read 2 more answers
A controlled experiment is one that_______________.
Pachacha [2.7K]

Answer:B

Explanation:

5 0
3 years ago
Of the following examples, which is likely to contain plasma?
-BARSIC- [3]

Answer:

Lightning

Explanation:

The term plasma referred to that condition when the electrons are "freed" from their host atoms for a short time. It happens due to the high temperatures.

Lightning is a plasma because when a column of electrons moves from sky to ground, the air that it passes through lights up with energy. What we see as lightning is the air. In this air,  the electrons are excited and giving off light. We see it as a light.

From this brief discussion, we can say that as electrons become free and become excited and then give light, lighting is a plasma.

5 0
4 years ago
Other questions:
  • Which clinical manifestation occurs in a client with vasopressin deficiency?
    10·1 answer
  • What supplies energy in an electric circuit
    9·2 answers
  • The discovery of mitochondrial DNA (mtDNA) had no effect on which area of scientific investigation?
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • SPONCH is a word that can help us remember elements that are a.not needed in living things B.most prevalent in living things C.f
    9·1 answer
  • drag the labels onto the flowchart to show the relationship between the production of photons by the sun (engelmann light source
    7·1 answer
  • what can people do that helps create antibiotic resistant bacteria and why is it bad for health care (i need a paragraph or almo
    14·1 answer
  • In an ecosystem, carbon and oxygen are both
    11·1 answer
  • During alcoholic fermentation, when is NAD+ converted to NADH -- during the conversion of glucose to pyruvate (glycolysis) or du
    11·1 answer
  • Help me please help
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!