1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
5

Instructions on how to control your cells are contained in what part of the DNA?

Biology
2 answers:
Virty [35]3 years ago
8 0

Answer:

D. Nucleotide bases

Explanation:

Hope it helps.

spayn [35]3 years ago
4 0

Answer:

a

Explanation:

trust

You might be interested in
Which is an example of visual data with regard to computer crime
AleksandrR [38]

"Image" is an example of visual data with regard to computer crime.

<u>Explanation:</u>

An act committed by a skilled or professional user of computers, also named as hacker who secretly browses or steals private information from a company or individual's system therefore this whole process is known as "computer crime".

Image is one of the best source or evidence in the form of visual data with respect to computer crime. Because many details can be collected or fetched out just from visual figures or pictures. It can contain codes, relatable links or some factors which can be helpful for targeting culprit.

6 0
3 years ago
True or false? all the characteristics of life are interrelated
Ede4ka [16]

The awnser is true!! I hope this helped!

3 0
3 years ago
Read 2 more answers
A scientific law and scientific theory can be used interchangebly. True or false?
lianna [129]
Most scientists don't used the word law because that implies it is infallible but generally scientific laws and theories are used interchangeably so true.
4 0
3 years ago
What is the answer to this question
emmainna [20.7K]

Answer:

D penguins. an stay warm in cold artic waters

Explanation:

lipids carry extra energy and store it

3 0
4 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
Other questions:
  • Most genes come in alternative forms called
    12·2 answers
  • Burning fossil fuels affects which biogeochemical cycle?
    8·1 answer
  • Is an experiment in which participants do not know if they are in the experimental or the control group, but the experimenters d
    5·1 answer
  • In the equation below, identify which side has more entropy and why.<br><br> CaCO3→CaO+CO2
    8·1 answer
  • Which part of a plant has the potential to produce a lateral shoot?
    7·1 answer
  • Why do lunar and solar eclipses not happen every month
    11·2 answers
  • What is the elevation of the X on the topographic map shown below
    12·1 answer
  • Someone help me please, I’ll mark brainlist or whatever it’s called quick
    11·1 answer
  • Cells from a squirrel are considered eukaryotic and bacteria cells are prokaryotic because -​
    10·1 answer
  • Which of the following best describes the matter present in an ecosystem?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!