1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firlakuza [10]
3 years ago
8

Which group of the pediatric population is at a higher risk of developing respiratory complications upon administration of gener

al anesthesia?
Biology
1 answer:
skelet666 [1.2K]3 years ago
8 0

Neonates are at a higher risk of developing respiratory complications upon administering general anesthesia

Explanation:

Anesthesia can lead to a number of perioperative and postoperative respiratory complications especially in neonates. Neonates may require varying levels and types of anesthesia for various conditions starting from central line or VP shunt placement, tracheostomy or gastrostomy tube placements, any excisions, circumscision and any other surgical procedures.  

The immature neonatal respiratory system makes neonatal anesthesia a difficult task due to:

Anatomically, the airways are small and alveoli network is immature.

Physiologically, neonatal metabolic rate is very high with more oxygen consumption than adults

Functionally, the lung mechanism is also immature, smaller upper airway resistance and higher lower airway resistance which causes collapse.

Hence, proper care should be taken while anesthetizing neonates with proper communication with the healthcare team including pediatric surgeons, pulmonologist, cardiologist, nursing care, pharmacists etc

You might be interested in
.................................
d1i1m1o1n [39]
Yes that’s circlet make me brainiest
7 0
2 years ago
Read 2 more answers
Which of the following is the main purpose of mitosis? A. to copy the cell’s DNA B. to divide the cytoplasm C. to help the cell
Sliva [168]
The answer is most likely D, as mitosis is the process of splitting a parent cell into two daughter cells. 
3 0
3 years ago
Two primary factors of Extinction​
zaharov [31]

introduction,disease

5 0
2 years ago
Read 2 more answers
The hantavirus outbreaks in the eastern hemisphere (asia) are identified with pulmonary failure, and have been referred to as "h
9966 [12]

The hantavirus outbreaks in the eastern hemisphere (Asia) are identified with pulmonary failure and have been referred to as "hantavirus pulmonary syndrome" (HPS).

The given statement is b) false.

Hantavirus pulmonary syndrome is an extraordinary infectious sickness that starts with flu-like signs and symptoms and progresses swiftly to a greater severe disorder. It can cause life-threatening lung and coronary heart issues. The disease is likewise known as hantavirus cardiopulmonary syndrome.

Early signs are widespread and encompass fever, fatigue, and muscle ache. other signs and symptoms can also consist of headache, nausea (a sense of illness in the stomach), vomiting, diarrhea (loose stool/latring), and dizziness.

Learn more about hantavirus here: brainly.com/question/16906890

#SPJ4

4 0
2 years ago
Early settlers in the town of Dry Gulch drilled wells to pump as much water as they wanted from the single aquifer beneath the t
OleMash [197]

Answer: B. under use; it is a scarce resource.

Explanation:

Early settlers in the town of Dry Gulch drilled wells to pump as much water as they wanted from the single aquifer beneath the town. (An aquifer is an underground body of water.) As more people settled in Dry Gulch, the aquifer level fell and new wells had to be drilled deeper at higher cost.Residents of Dry Gulch have a private incentive to under use water because it is a scarce resource.

8 0
3 years ago
Other questions:
  • The percentage of U.S. buildings that suffer from poor indoor air quality is about percent
    12·1 answer
  • Pure chlorine is an example of a(n) _____.<br><br> element<br> compound<br> mixture<br> solution
    11·2 answers
  • How does pollution cause a reduction in biodiversity?
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is a benefit of using nonrenewable resources?
    13·2 answers
  • The chemical synapse is bounded by the ________ neuron, from which neurotransmitters are released across the synaptic cleft, to
    8·1 answer
  • The wild-type allele for a gene has more base pairs than the mutated form of the allele. Which type of mutation occurred? base p
    13·2 answers
  • The powerhouse of the cells are a.mitochondria b.centrioles c.chloroplasts d.vacuoles
    15·1 answer
  • Some people see hydroelectric energy, energy harnessed from water movement, as a clean alternative to fossil fuels. Others belie
    15·1 answer
  • A type of grass is planted in someone's backyard to look visually appealing but has a toxin that prevents local animals from suc
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!