Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
15 chromosomes
Explanation:
The endosperm is formed through double fertilization where one male gamete nucleus with polar nuclei to form a triploid nucleus called the primary endosperm. The endosperm therefore will contain 15 chromosomes since the polar nuclei is diploid and the male gamete is haploid forming a triploid nucleus.
DNA to 8. the genetic blueprint for all cells
Nucleus to 5. acts as the "brain" of a cell
Connective cells to 9. tendons, blood, and fat are examples of these cells.
Epithelial tissues to 6. designed to regulate temperature, secrete lubricants, and protect the body from harmful substances.
Cytoplasm to 7. fluid like substance in a cell
Organelles to 3. structures that perform special functions within a cell
These are the only ones I know.
Answer:Search Results
Featured snippet from the web
Because one parent contributed a C and the other contributed an s, the child will have both genes and their hair will be wavy. (Although curly hair is technically dominant, hair type is an example of incomplete dominance, so the curly hair doesn't cancel out the straight hair entirely.
Explanation: that what i know
