1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
avanturin [10]
3 years ago
7

The dumping of garbage caused the population of crabs in an area to drop from 2,000 to 500. Crabs eat algae and are preyed on by

larger fish. How will the crab’s population change affect these two species?
Biology
2 answers:
xeze [42]3 years ago
8 0

Answer:

B: The population of predatory fishes will change.

C: The biodiversity of the ecosystem will decrease.

D: The algal population will increase.

Explanation:

I promise these are all the correct answers, I just took the test.  :)

Lana71 [14]3 years ago
4 0
Crabs and algae will die in the area
You might be interested in
Differentiate between blood types O+ and O- properties. Explain the type of donor O- is and what type of blood an O- person shou
Masja [62]
People with O+ blood cannot donate their blood to negative blood types, while people with O- blood can donate to any blood type. This makes them the "universal donor." However, they can only receive O- blood.
7 0
3 years ago
Read 2 more answers
The epidermis is the most superficial layer of the skin. It is composed of stratified squamous epithelium. Within the epidermis,
son4ous [18]

Answer:

a. Stratum corneum 5. : Thick superficial layer of flat, keratinized, dead cells; responsible for dandruff.

b. Stratum granulosum 3.: Cells flatten and fill with keratin, resulting in a grainy appearance.

c. Stratum lucidum 4. : Clear layer found only in thick skin; cells full of keratin.

d. Stratum basale 1. : Deepest layer; site of rapid cell division and melanin production.

e. Stratum spinosum 2.: Live keratinocytes connected by desmosomes produce pre-keratin

Explanation:

The epidermis has five layers, starting from the deepest one they are:

The stratum basale: is the layer that has the germinative cells, called keratinocytes.

The stratum spinosum: the keratinocytes are connected, and they produce the precursor of keratin and lipids.

The stratum granulosum: the name of this stratum is due to the appearance of the cells. They produce keratohyalin, and the lipids produced in the previous layer are released, creating the layer that protects the skin against dehydration.

The stratum lucidum: They are only in thick skin, like the one that is in the sole of our feet. The cells do not have a nucleus. They are filled with keratin, which is the component of thick skin.

The stratum corneum: the more superficial layer, it is made of dead cells filled with keratine. When new cells ascend to this stratum, the old ones have to be removed by exfoliation or natural peeling.

4 0
3 years ago
What role do proteins play in enabling the enormous amount of dna in a eukaryotic cell?
MAVERICK [17]
DNA is condensed by a certain amount just on its own, just by its own interactions within the DNA molecule,..but whne proteins get involved it gets condensed 30000 fold 
<span>what happens is that proteins called histones are like hockey pucks, and DNA wraps around it 1.5 times and then goes to another histone and wraps around that so that it looks like beads on a string (i hope that makes sense, its the only way to describe it) </span>
<span>these histones condense this DNA a lot, and when the histones get methylated then the DNA packs together even closer to get heterochromatin (VERY densely packed DNA)...the theory here is that DNA has a net negative charge due to the phosphate groups in the DNA backbone and doesnt allow the DNA to come together as closely as it could (like charges repel like charges), but when histones are methylated, the negative charge on the DNA is masked by the methyl groups and DNA can come together closer </span>
5 0
3 years ago
The energy needed for the changes in the water cycle to take place comes
ollegr [7]

Answer:

The water cycle is driven primarily by the energy from the sun. So basically the answer is D. the sun

Please correct me if I am wrong

Explanation:

4 0
3 years ago
Read 2 more answers
What does your body convert into energy
asambeis [7]
<span>This energy comes from the food we eat. Our bodies digest the food we eat by mixing it with fluids (acids and enzymes) in the stomach. When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose.
hope i helped :)
</span>
6 0
4 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How can the polar jet stream influence weather if it dipped farther south over Florida? Explain.
    8·1 answer
  • What is the main difference between sulfate minerals and sulfide minerals?(17 points) plz help me :(
    15·1 answer
  • What is the first structure to prevent water loss in the leaf called
    10·1 answer
  • Why is still water an ideal environment for the formation of mold and cast fossils?
    10·2 answers
  • During a pet scan, a london cabby is asked to describe the route she would take a fare from the west end theater district to har
    6·1 answer
  • What role does dna replication play in the cell cycle
    13·1 answer
  • Which of the following occurs when air is compressed
    7·1 answer
  • Can someone please help
    10·1 answer
  • A man who heavily smokes has developed lung cancer. The tobacco smoke has caused mutations in some of the cells in his lungs, ma
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!