1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
3 years ago
10

A diffuse, nontoxic goiter is usually due to a lack of _____ in the diet.

Biology
1 answer:
prohojiy [21]3 years ago
5 0

Answer;

Iodine

A diffuse, nontoxic goiter is usually due to a lack of Iodine in the diet.

Explanation;

-A diffuse non-toxic goiter is an enlargement of the thyroid gland without nodularity. It occurs in an endemic and sporadic distribution. It does not result from an inflammatory or neoplastic process and is not associated with abnormal thyroid function.

-Simple nontoxic goiter, which may be diffuse or nodular, is noncancerous hypertrophy of the thyroid without hyperthyroidism, hypothyroidism, or inflammation. Except in severe iodine deficiency, thyroid function is normal and patients are asymptomatic except for an obviously enlarged, non tender thyroid.

You might be interested in
what hormone secreted by the duodenum inhibits secretion of gastric juices and stimulates the release of insulin?
Sveta_85 [38]

Answer:

Gastric Inhibitory Peptide

Explanation:

3 0
3 years ago
Which statement best explains how each of the different cell types can develop from the same embryo
Jet001 [13]
We don’t know cuz u don’t have any of the answers
7 0
3 years ago
Read 2 more answers
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Breeding stock can receive implants true or fakse
Rudik [331]
Fakse Breeding stock should not be given implants
3 0
3 years ago
Read 2 more answers
Which statement explain what will happen during the Asteroid Redirect Mission? Check all that apply.
Lady_Fox [76]

Answer:

The main objective of the Asteroid Redirect Mission was to develop deep space exploration capabilities needed in preparation for a human mission to Mars and other Solar System destinations per NASA's Journey to Mars flexible pathways.

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the general population limit of a galaxy group?<br> 5<br> 50<br> 100<br> 1000
    13·1 answer
  • consider the following data. which would have to happen to make the population growth of cheetahs in 2013 equal to the populatio
    8·1 answer
  • What are the fingerlike projections of the small intestine that increase the absorptive surface area?
    9·1 answer
  • What type of graph is used to compare data? Group of answer choices bar graph scatter plot line graph pie chart
    13·1 answer
  • bacteria double every generation. if one bacterium is in first generation, how many bacterium will there be in the sixth generat
    13·1 answer
  • 2. Tabby stripes (T) is dominant to solid colored fur (t). If there are 168 tabby stripped cats in a population of 200
    14·1 answer
  • What is the range for the following set of measuremen? 7.1 g, 9.8 g, 2.3 g, 8.5 g, 7.4 g, 5.7 g
    14·2 answers
  • Select the correct answer.
    9·2 answers
  • steel is a mixture of iron and carbon.it cant be separated into iron and carbon by melting it.what is steel?
    10·1 answer
  • What is the correct order of the following layers, from youngest to oldest?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!