1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa05 [86]
3 years ago
8

Draw a punnett square to show the possible allelic combinations for this gene in the f1 generation (note, all parental generatio

n flies are homozygous for selected traits). you do not need to keep track of gender unless you believe it is a factor in this cross.
Biology
1 answer:
melomori [17]3 years ago
7 0
Same I can’t figure it out
You might be interested in
Is when the brain develops a chemical need for a substance. (1 point)
Oduvanchick [21]
Dependence is the answer
8 0
3 years ago
Energy is greatest when the most energy is stored?
taurus [48]
Yes I had this question in my chemistry class
5 0
2 years ago
The monomers of nucleotides are?
DerKrebs [107]

Answer:

Nucleotides are organic molecules consisting of a nucleoside and a phosphate. They serve as monomeric units of the nucleic acid polymers deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), both of which are essential biomolecules within all life-forms on Earth.

Explanation:

3 0
3 years ago
Explain why the number of red and yellow kernels on the ear of corn represents the results of cross that is observed
Grace [21]

Answer:

The red kernels are the dominant trait and will be more numerous on the ear of corn than the yellow. This happens because its dominance mearns that if it is a combination of either RR or Rr, it will still take over the r trait. The only time the yellow can be expressed entirely Is when the combination is rr.

3 0
2 years ago
The blackberry is an example of which of the following fruit types?
leonid [27]
If i am not mistaken it is the aggregate fruit classification

3 0
2 years ago
Other questions:
  • The principle of _____ suggests that a gene pair separates during gamete formation?
    11·2 answers
  • What is the group number of the most nonmetallic group that contains metalloids?
    5·1 answer
  • A boundary between nonsedimentary and sedimentary rocks is an example of which type of unconformity?
    9·1 answer
  • What was Frederick mieschers contribution to the discovery of genetic code
    8·1 answer
  • The membrane-bound protein molecules that pass electrons along the Electron Transport System chain are called:
    10·1 answer
  • ¿Cómo continúan los humanos fragmentando el<br> hábitat y creando "islas"?
    7·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Which organelle produces proteins
    8·2 answers
  • Free 10<br>Have a good day <br>:^D
    10·1 answer
  • Sort...
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!