1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
8

Which of the following statements is true about external and internal fertilization?

Biology
2 answers:
Mice21 [21]3 years ago
6 0

Answer: A. external fertilization doesn’t require sexual intercourse.

Explanation:

Fertilization is a process of fusion of the male and female gametes of the organisms so as to produce zygote a precursor of new life. In living beings the fertilization is of two types named as external and internal fertilization.

In external fertilization the fusion of the gametes of opposite sex takes place outside the body of the organism. It is used by some aquatic organisms like fishes they lay their eggs in water which are fused by the male sperms also released in water. In external fertilization no direct sexual intercourse takes place.

In internal fertilization the fusion of the male and female gamete takes place inside the body of the female mate. This occurs due to direct sexual intercourse between the male and female partners.

NeX [460]3 years ago
4 0

Answer:

A is correct external fertilisation doesn't require sexual intercourse

You might be interested in
These three questions​
skad [1K]

Answer:

Respiration

Canine

Where is lll ?

6 0
2 years ago
Which is NOT part of cell theory?
nekit [7.7K]

Answer:

cells contain membrane- bound organelles

8 0
2 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
BLANK can disrupt cellular homeostasis and can even lead to uncontrolled cell division and the formation of cancers.
Sunny_sXe [5.5K]
It is either carcinogens or viruses (I think the first) I hope this helps!
5 0
3 years ago
Read 2 more answers
Which are true?
Pavel [41]

Answer:

C, D, E

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement describes a shield volcano
    9·1 answer
  • What is the identity of the atom shown?
    8·2 answers
  • A nurse is asked which mineral calcitonin and parathyroid hormone regulate. how should the nurse respond?
    10·1 answer
  • What is the function of the organelle labeled number 9 in the image above?
    9·1 answer
  • Chris, who works at a pesticide factory, comes to the clinic complaining of muscle spasms that interfere with his movement and b
    14·1 answer
  • Why is water so susceptible to pollution?
    6·2 answers
  • "what part of the antibody's structure determines its class?"
    9·2 answers
  • Explain how a genetic map (in map units) is related to actual physical distance (in base pairs of DNA).
    12·1 answer
  • Why do you think Hawaii has a “High” level of risk?
    6·2 answers
  • Elizabeth has always believed that people’s thoughts can help heal them. She wants to help people use positive thinking to posit
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!