1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miss Akunina [59]
3 years ago
9

What is the local maximum over the interval {-3, 1.5} for the graphed function

Mathematics
2 answers:
Eddi Din [679]3 years ago
8 0
The correct answer is: 56
kondaur [170]3 years ago
6 0

Answer:

The answer to that one is 56. I got the question correct on the test.

Step-by-step explanation:

You might be interested in
Please help me asapp
Ede4ka [16]

Answer:

<h2>It is h=1.5 yd</h2>

Step-by-step explanation:

a = b \times h \\ \\  a = 9 \:  \:  {yd}^{2}  \\ b = 6 \:  \: yd \\  \\ 9 = 6 \times h \\ h =  \frac{9}{6}  \\ h = 1.5 \:  \: yd

I hope that is useful for you :)

6 0
3 years ago
Figure ABCD was reflected across the x-axis to create figure A'B'C'D'.
slamgirl [31]

Answer:

hii

Step-by-step explanation:

Malappuram kzdkfdkfzl

6 0
3 years ago
Read 2 more answers
PLEASE HELP<br> what is the value of x in the diagram?<br> a. 15<br> b. 5 2/5<br> c. 19<br> d. 3/5
vichka [17]
I'm pretty sure the answer is A) 15 I could be wrong though
5 0
3 years ago
Read 2 more answers
What does insignificant mean
rodikova [14]

"Insignificant" means it's so small that it doesn't have any effect
on the outcome, result, answer, group, or environment.  You can
ignore it, and pretend that it's not even there.

3 0
4 years ago
Read 2 more answers
What is the absolute value of [-2/3]
Aleksandr [31]

Answer:

2/3

Step-by-step explanation:

Absolute values are always zero or positive.  Thus, |-2/3| = 2/3

4 0
4 years ago
Other questions:
  • Enter a digit in each box to complete the division problem.
    7·1 answer
  • Almost a billion people on the planet don't have access to clean drinking water." if there were 7.2×109 people in the world in 2
    12·2 answers
  • 6-b=5b+30 how do I solve this
    13·2 answers
  • 2 digit divisor and 3 digit dividend...does the quotient always have the same number of digits?
    13·1 answer
  • Write an equation of the line that passes through a pair of points: (-3,1), (-2,-5)
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is the solution to the equation 3/m+3-m/3-m=m^2+9/m^2-9
    9·1 answer
  • Solve the<br> inequality for n<br> 22 &lt; n - 6
    9·1 answer
  • PLZ HELP ASAP! WILL GIVE BRAINLIEST AND 30 POINTS!!
    12·1 answer
  • please help this is 244 points of my grade I've already tried -4/3 on the one equation and it didn't work and I know slope formu
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!