1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr1967 [171]
4 years ago
11

Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that will then code for a protein,

mutations in the DNA can affect the final product. Depending on the severity of the mutation, the protein can range from not being affected to being rendered completely nonfunctional, especially if the reading frame is altered. Which of the following represents a change in reading frame if the template strand of DNA reads as follows?
A) AGCTGGACTTTAGACAAG
B) AGCTGGACTTTAGACAAG
C) AGCTGGACTTGAGTGAACAAG
D) AGCTGGACTATAGACAAG
E) AGCUGGACUUUAGACAAG
F) AGCTGCGACTTTAGACAAG
Biology
1 answer:
Serjik [45]4 years ago
8 0

Answer:

AGCTGCGACTTTAGACAAG

Explanation:

The response is AGCTGCGACTTTAGACAAG because this mutation has a number of nucleotides that is not multiple of three bases for codon, which is required for the synthesis of amino acids. In consequence, this mutation will change the reading frame in which ribosome reads the sequence of the mRNA

You might be interested in
Two people,both with AB blood have 4 children . What blood types should the children be
lina2011 [118]
Ab blood because mom and dad both have ab
3 0
3 years ago
Read 2 more answers
How is modern Earth different from Earth over four billion years ago?
Alex_Xolod [135]

Answer:

c and b

Explanation:

cause I believe that because of the populations and polutions that is cause of humans we are now lack of protective shield and green gases within our atmosphere

5 0
3 years ago
Read 2 more answers
Which of the following would have an effect on an object's weight?
dybincka [34]
I'm guessing changing gravity
8 0
3 years ago
Read 2 more answers
If organelles were not functioning properly, which of the following would be true?
Serggg [28]

Answer:

f organelles were not functioning properly, which of the following would be true?

A. Both unicellular and multicellular organisms would not be able to carry out the life functions to maintain homeostasis.

B. Only unicellular organisms would not be able to carry out the life functions to maintain homeostasis.

C. Only multicellular organisms would not be able to carry out the life functions to maintain homeostasis.

D. Both unicellular and multicellular organisms would function normally.

Explanation:

7 0
3 years ago
In which direction does dna polymerase make new strand of dna
LenKa [72]

DNA polymerase moves along the old strand in the 3'-5' direction, creating a new strand having the same 5'-3' direction.

8 0
3 years ago
Other questions:
  • The enzyme ___________ starts transcription by binding to the gene that is being transcribed and moves down the DNA strand, brin
    11·2 answers
  • Which best describes how the sun rotates? A.The sun does not rotate. B.The sun rotates every 11 years. C.The sun rotates once ea
    11·2 answers
  • When a female mammal's ova are ready to be fertilized, we say she is in estrus or "in heat."
    14·2 answers
  • How does the ratio of the two types of melanin you have affect your skin color?
    5·2 answers
  • A ______ is a chemical substance used for communication that is produced at one site in the body and then carried in the blood t
    14·1 answer
  • Descriptive data is also called _________ data.
    13·1 answer
  • Which example describes an abiotic factor interacting with a biotic factor?
    15·1 answer
  • Imagine a postsynaptic neuron is experiencing multiple simultaneous incoming synaptic potentials, which were caused by the activ
    15·1 answer
  • When you ride in your car and the trees and buildings appear to you to move backward, you are observing motion.
    14·1 answer
  • A bacterial cell is in a solution with a chemical gradient. The bacterial cell directs its movements in order to move toward the
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!