1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr1967 [171]
4 years ago
11

Given that the sequence of nucleotides in a DNA strand will be used to produce an mRNA strand that will then code for a protein,

mutations in the DNA can affect the final product. Depending on the severity of the mutation, the protein can range from not being affected to being rendered completely nonfunctional, especially if the reading frame is altered. Which of the following represents a change in reading frame if the template strand of DNA reads as follows?
A) AGCTGGACTTTAGACAAG
B) AGCTGGACTTTAGACAAG
C) AGCTGGACTTGAGTGAACAAG
D) AGCTGGACTATAGACAAG
E) AGCUGGACUUUAGACAAG
F) AGCTGCGACTTTAGACAAG
Biology
1 answer:
Serjik [45]4 years ago
8 0

Answer:

AGCTGCGACTTTAGACAAG

Explanation:

The response is AGCTGCGACTTTAGACAAG because this mutation has a number of nucleotides that is not multiple of three bases for codon, which is required for the synthesis of amino acids. In consequence, this mutation will change the reading frame in which ribosome reads the sequence of the mRNA

You might be interested in
Analyze the results of a cross between two organisms that are both heterozygous for two different genes (AaBb). Use a Punnett sq
Xelga [282]
1) all the possible genotypes are also identified by color in the image below :AABBAAbB or AABbaABB or AaBBaAbB or aABb or AabB or AaBbAAbb 
aAbb or AabbaaBB
aabB or aaBbaabbThere are 9 different genotypes in total. These can be achived by mixing the alleles of both genes of each parent (just like it's represented in the square).

2) there are 4 phenotypes
-one with an allele A and allele B that would dominate the other. (AABB, aAbB, for example)
- one with all alleles recessive-  aabb
-one with the recessive alleles in the gene A but heterozygotic/homozigotic dominant for gene B ( for example: aaBB)
-one with the recessive alleles in the gene B but heterozygotic/homozigotic dominant for gene A ( for example: Aabb)

3) <span>probability of having offspring with the aabb genotype: 1/16
Just by looking at the punnet square, you can see that only one has the aabb genotype, in all the 16 possibilities.
</span>

6 0
4 years ago
Which of the following phase changes would absorb energy as it occurs?
lord [1]
The answer is A. melting. The change from gas to liquid to solid will release energy and the change from solid to liquid to gas will absorb energy. So the other three are releasing energy.
5 0
4 years ago
Which species is responsible for the blue color that appears during the iodine clock reaction?.
Nonamiya [84]

Answer:

Amylose in starch is responsible for the formation of a deep blue color in the presence of iodine.

Explanation:

The iodine molecule slips inside of the amylose coil. Iodine - KI Reagent: Iodine is not very soluble in water, therefore the iodine reagent is made by dissolving iodine in water in the presence of potassium iodide.

5 0
3 years ago
Sixty-four-year-old Jeffery Thomson has been diagnosed with esophageal cancer. He has experienced a 20-pound weight loss in the
Shalnov [3]

Answer:

Factors than can decrease the risk of esophageal cancer include intake of FOODS THAT ARE HIGH OR RICH IN VITAMIN C

Explanation:

Esophageal cancer can also be known as the cancer of the oesophagus.

Esophageal cancer is caused by either genetic reasons or by a continuous smoking activity. Sometimes when people experience a terrible acid reflux in their system, there is a tendency they might have esophageal cancer.

Common symptoms of esophageal cancer includes:

a. Heart burn

b. Indigestion

c. Unexpected weight loss

d. Pain in the chest area

e. Consistent coughing

f. Pain and difficulty with swallowing foods.

Esophageal cancer can be effectively managed by

a) Used of chemotherapy

b) Use of other kinds of drugs.

c) Consumption of fruits that are rich in vitamin C.

4 0
3 years ago
Read 2 more answers
What type of energy makes heat
taurus [48]
C. kinetic energy

On a microscopic scale, conduction occurs as rapidly moving or vibrating atoms and molecules interact with neighboring particles, transferring some of their kinetic energy.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following relationships is an example of commensalism
    10·1 answer
  • Answer the question pls
    13·1 answer
  • Pair of genes on a chromosome that is linked to heredity traits is called
    15·1 answer
  • What happens to a series circuit consisting of three light bulbs if a new light bulb is added to the circuit?
    9·1 answer
  • Two hydrogen bonds are formed between all base pairs (C to G and A to T).<br> a. true <br> b. false
    7·1 answer
  • Which of the following definitions best describes biology?
    6·2 answers
  • What can you use to see all the<br> different colors in white light?
    6·2 answers
  • If your oxygen levels are too low, your respiration rate would _________. <br> increase or decrease
    11·1 answer
  • Compare series circuits to parallel circuits
    12·1 answer
  • Enzymes that break down food are located in the?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!