1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DochEvi [55]
4 years ago
8

Which statement describes the ability of the cell membrane to allow various substances to move through it?

Biology
2 answers:
sineoko [7]4 years ago
7 0

Answer:   the cell membrane is selectively permeable

Explanation:

Alika [10]4 years ago
7 0
A) it is selectively permeable
You might be interested in
Which of the following systems does NOT excrete some form of waste?
UkoKoshka [18]

Answer:

I believe it would be the muscular system

Explanation:

The digestive excretes the not needed food in your body, (I won't go into detail) The respiratory excretes Carbon dioxide which would be a form of waste.

5 0
3 years ago
How do individuals contract African sleeping sickness?
EastWind [94]

if they receive a bite from an infected tsetse fly

5 0
3 years ago
If an insect eats a plant and a bird eats the insect, about how much energy from the plant is stored for the insect to use?
Anton [14]

Answer:

90%

Explanation:

3 0
3 years ago
Partial inspections usually
dybincka [34]
The answer for this question is B. Don't require a pre-inspection agreement


Hope I helped please branliest answer if possible

5 0
4 years ago
Nonvascular plants have a system that transports water and nutrients throughout the plant’s body
solniwko [45]

Answer:

False

Explanation:

Plants, based on whether they can conduct water and nutrients, are classified into vascular and non-vascular plants. Vascular plants also called TRACHEOPHYTES are plants that possess certain special tissues called vascular tissues used for conducting water and nutrients in a plant. These conducting tissues are xylem and phloem.

On the other hand, non-vascular plants do not possess vascular or conducting tissues, hence, they cannot transport water and nutrients throughout the plant. Hence, such plants are naturally found in moist areas e.g. mosses. Therefore, based on the question asked, the answer is FALSE.

4 0
3 years ago
Other questions:
  • Which Soil cannot be rolled into Balls or Clumps
    12·2 answers
  • Which processes of the water cycle move water from the atmosphere into surface water reservoirs?
    14·1 answer
  • Cual es la diferencia entre sabana y desierto.
    15·1 answer
  • One method for separating polypeptides makes use of their different solubilities. The solubility of large polypeptides in water
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • In which direction does wave energy travel
    12·2 answers
  • What compound is this? <br>Carbohydrates <br>Lipids<br>Nucleic acids<br>Proteins ​​​
    14·1 answer
  • Can someone please help me with this biology question?
    13·2 answers
  • Write down a mechanism for increasing genetic variation in BOTH eukaryotes and prokaryotes.
    10·1 answer
  • Question 1
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!