1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Burka [1]
2 years ago
7

What type of bug is this?

Biology
1 answer:
lara31 [8.8K]2 years ago
4 0

Answer:It looks like a beetle

Explanation:

You might be interested in
Which phrase best explains the term gene expression?
xenn [34]
What are the phrase options ??
5 0
2 years ago
The 14 different species of finches in the galapagos islands originated from a single ancestral species. what is it about these
Daniel [21]
<span>These islands have different ecologies and most are not connected to each other by landmass. Therefore, the organism adapt to each of the different ecologies on their islands. These populations were physically separated due to lack of connection to each other and would not breed randomly. They therefore formed different species by allopatric speciation.</span>
8 0
2 years ago
Explain why cells are typically small?
Tom [10]
Because there are millions in our body
7 0
3 years ago
1. During RNA processing a(n)___________ is added to the 5' end of the RNA. A. 3' untranslated region. B. a long string of adeni
Svetradugi [14.3K]

Answer and Explanation:

  1. During RNA processing a(n)<u> modified guanine nucleotide</u> is added to the 5' end of the RNA
  2. During RNA processing a(n) <u>a long string of adenine nucleotides</u> is added to the 3' end of the RNA.
  3. Spliceosomes are composed of <u>snRNPs and other proteins</u>.
  4. The RNA segments joined to one another by spliceosomes are <u>exons</u>
  5. Translation occurs in the <u>cytoplasm</u>
6 0
3 years ago
The M phase of the cell cycle consists of both mitosis and cytokinesis. Mitosis refers to ______________, whereas cytokinesis re
Fed [463]
The company is a little bit better than a regular basis and the food was Avery but it was not
5 0
3 years ago
Other questions:
  • How did birds survive the environmental changes that have occured on the Earth?
    7·1 answer
  • Evolution means________. <br><br>a:- translocation<br>b:- gradual development
    5·2 answers
  • What would happen if decomposition did not occur?
    5·1 answer
  • When a cells volume becomes to great for the surface area to maintain the cell will A) die. B) divide. C) grow. D) move.
    12·1 answer
  • The equation shows cellular respiration. During cellular respiration, glucose combines with oxygen to form carbon dioxide,
    6·1 answer
  • Using the principle of independent assortment, complete the Punnett square to show the results of an F1 cross between two indivi
    15·1 answer
  • A. What gases were present in Earth's early atmosphere?
    14·1 answer
  • Name the type of element that has luster, conducts electricity and is malleable
    8·1 answer
  • Why do fluctuations in abiotic cycles have an impact on living organisms and on ecosystems as a whole?
    13·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!