1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nuetrik [128]
3 years ago
15

Where is the important information being stored in dna?

Biology
1 answer:
Romashka-Z-Leto [24]3 years ago
6 0
The genetic information is the sequence of nucleotides in DNA. The sequence is important because the coding units triplets of nucleotides and depending on the triplets and the order of the triplets, it's the RNA and eventually the protein that gets made.
You might be interested in
What is the difference between a unicellular organism and a multicellular organism
VikaD [51]

Answer: A unicellular organism consists of 1 single egg, and a multicelluar organism consists of 2 or more eggs.

Explanation:

5 0
3 years ago
Significant amounts of phosphorus are found in all locations on Earth except the..
Eduardwww [97]

Answer:

Atmosphere

Explanation:

Phosphorus cycle in nature is a unique cycle compared to the other natural biological and chemical cycles such as the carbon, nitrogen, sulfur and water cycles, as there is no gaseous phase in the phosphorous cycle. Due to the prevailing atmospheric temperature and pressure which are not appropriate for the formation of gases associated with phosphorus, the compounds in nature where phosphorus can be found are not gases. Phosphorus can therefore be found majorly in sedimentary rocks.

6 0
3 years ago
What is the result at the end of meiosis II? A. two haploid cells B. four haploid cells <-------- C. two diploid cells D. fou
madreJ [45]
Four haploid cells each chromosome containing 2 sister chromatids.

you are right, it's B.) 4 haploid cells
6 0
3 years ago
What is the most significant role of homologous recombination in eukaryotes that is not found in prokaryotes? exchange of geneti
Luden [163]

Answer:

The correct answer is "exchange of genetic information between parental chromosomes".

Explanation:

Homologous recombination is a genetic recombination that occurs when two similar or identical molecules of DNA exchange some of its nucleotide sequences. This type of recombination is most widely used for DNA repair purposes, however this is not distinctive of eukaryotes as prokaryotes use it as well. Therefore the most significant an unique role of homologous recombination in eukaryotes is the exchange of genetic information between parental chromosomes. This particular function is known as chromosomal crossover and it is only found in eukaryotes.

5 0
3 years ago
A hypothetical bacterium swims among human intestinal contents until it finds a suitable location on the intestinal lining. It a
Sonbull [250]

Answer:

(1). symbiont

Explanation:

The bacterium inside the human intestine is a symbiont and the bacterium-human interaction is a symbiosis of the commensalistic type.

Commensalism is a biological interaction (symbiosis) in which members of one species -in this case the bacterium- gain benefits while those of the other species -in this case the human- neither benefit nor are harmed.

5 0
3 years ago
Other questions:
  • Nutrients enter the bloodstream during the process of
    15·1 answer
  • Which of the following cellular environments is conducive to the formation of disulfide bonds within or between proteins? Choose
    8·1 answer
  • Complete explanations of the trophic levels
    7·1 answer
  • a nitrogen atom has 7 protons, and the most common isotope of nitrogen has 7 neutrons. A radioactive isotope has 9 neutrons. Wha
    13·1 answer
  • Transcription: Transcribe the DNA to make an mRNA molecule ATGA ACCATTCAGTATG Gb| Complimentary DNA mRNA Molecule​
    11·1 answer
  • What is involved in redox reactions
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • • Describe the distribution of electrons around the nucleus of an atom
    9·1 answer
  • Question 10 of 25
    8·1 answer
  • How are seatbelts related to inertia? Write you answer in complete sentences.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!