Answer:
By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.
Explanation:
By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:
AAGGGGTGACTCTAGTTTAATATA
You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:
TTCCCCACTGAGATCAAATTATAT
Use the rule and example and fill in the table.
The greatest part of the faery handbag is that there's a wrong way to open it — meaning a dangerous way, a way that can eat you alive. And it's that third compartment or “way of opening up” that separates the magical realism of childhood stories from the magical realism of stories for adults
Answer: B or c go with witch one you think is more correct.
Explanation:
D-the passage doesnt say anything about restrictions or fire arms
A- doesnt say anything about believes
Answer:
Miranda had made " The Hamilton Mixtape"as hip-hop with more sophisticated wording
Explanation:
I really like Hamilton I just rewatched it:D
It is by D. Varahamihira
<span>Brihadsamhita is the masterpiece of Varahamihira, the 6th-century Indian astrologer and astronomer.
</span>
Hope it helped! :)