1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tema [17]
3 years ago
6

Assuming this land was once a farmer’s field with previously established vegetation, which process does this photograph best rep

resent?
Primary Succession
Secondary Succession
Pollution
Biology
1 answer:
Greeley [361]3 years ago
8 0
The right answer for the question that is being asked and shown above is that: "Secondary Succession" Assuming this land was once a farmer’s field with previously established vegetation, the process that does this photograph best represent is secondary succession.
You might be interested in
What are the similarities and differences between food chains and food webs?
ra1l [238]
A food chain shows a single connected path of energy flow through an ecosystem. It shows the different levels of eating in an ecosystem. Both a good web and a good chain include a number of organisms including both producers and consumers. A food chain is very simple while a food web is complex and consists of a number of food chains. In a food chain each organism has only one consumer or producer.
4 0
3 years ago
What led biologists to assign universally accepted names to organisms? The need to create a unique name that would be recognized
matrenka [14]
Biologists assigned universally accepted names to organisms because t<span>hey needed to create a unique name that would be recognized as belonging to one organism.</span>
7 0
3 years ago
Read 2 more answers
Where is the indiana bat found in alabama and what is its habitat ( weather temperature other facts)
kenny6666 [7]
The habitat in indana of the bat is to feed
4 0
3 years ago
Read 2 more answers
A track team captain thinks that eating breakfast and having a good night's sleep may affect the team's performance.
mestny [16]

Answer:

I'm pretty sure the answer is A

3 0
3 years ago
Help ill make the best and write one the brainliest!!!
Ganezh [65]
Rock B may have many fossils.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which is NOT a defining characteristic of a mineral?
    5·1 answer
  • What do you think could be done to reduce levels of carbon dioxide in the atmosphere?
    6·1 answer
  • When plants undergo photosynthesis, they take in water and other nutrients from the soil and carbon dioxide from the air to prod
    10·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What happens to the nitrogen in a rabbits body<br>when it dies<br><br>​
    6·1 answer
  • How does the environment influence the likelihood of a species surviving and reproducing​
    7·1 answer
  • The first person generally credited with fulfilling the functions of the modern director was:
    9·1 answer
  • People in which environmental career category are directly involved in designing structures that aid humans to function in natur
    8·2 answers
  • What are 4 characteristics of populations? Explain each
    13·1 answer
  • Perumbeti A, Higashimoto T, Urbinati F, et al. A novel human gamma-globin gene vector for genetic correction of sickle cell anem
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!