1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
3 years ago
10

in sickle-cell disease variation is one gene cause red blood cells to bend or sickle this means the sickle cells

Biology
1 answer:
miskamm [114]3 years ago
3 0

Cannot carry normal levels of oxygen to cells

You might be interested in
Protein synthesis can can be incresed by
noname [10]

Answer:

Multiple sources of protein promote protein synthesis after exercise, but only those with essential amino acids elevate synthesis. ... Ten grams of essential amino acids or twenty-five grams of a complete protein are sufficient to maximally stimulate protein synthesis.

Explanation:

3 0
3 years ago
Read 2 more answers
Is the activation of receptors in the various sense organs?
GaryK [48]

Answer;

-Sensation

Sensation is the activation of receptors in the various sense organs

Explanation;

-Sensation is the activation of sensory receptor cells at the level of the stimulus. Perception is the central processing of sensory stimuli into a meaningful pattern. Perception is dependent on sensation, but not all sensations are perceived.

-Receptors are the cells or structures that detect sensations. A receptor cell is changed directly by a stimulus. A transmembrane protein receptor is a protein in the cell membrane that mediates a physiological change in a neuron, most often through the opening of ion channels or changes in the cell signaling processes.

4 0
4 years ago
Which offspring will be homozyguous dominant?
sukhopar [10]
Homozygous dominant is when 2 dominant alleles are present. Solve the punnett square and whichever boxes have 2 dominant (uppercase/capitalized) letters in it are homozygous dominant

I cannot read the letters on your picture very well, I'm sorry.
7 0
3 years ago
Read 2 more answers
What fossil is a copy of an organism's structure, formed when minerals seep into a mold in sediment?
eimsori [14]
<span>Cast is a fossil that is a copy of an organisms shape, formed when minerals seep into a mold. A fossil formed when an animal, plant, or other organism dies, its flesh decays and bones deteriorate due to chemical reactions; minerals gradually enter into the cavity, resulting in a cast, also called a mold fossil, which is in the general form of the original organism.</span>
5 0
3 years ago
WRITE A E-MAIL
ss7ja [257]

Answer:

{Dear:friends name}

I'm writing this letter to tell you congrats on getting admitted into your dreams school!!

I know how nervous you were when the letter came.

i'm going to miss seing you around but i know that you are going to have so much fun when school starts up again .

6 0
3 years ago
Other questions:
  • HELP PLEASE Sucrase, lactase, and maltase break down disaccharides into monosaccharides. Monosaccharides are transported to the
    10·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • 3/
    9·1 answer
  • What are the four steps you can follow to help you comprehend health concepts related to health promotion and disease prevention
    12·1 answer
  • Genes are portions of the DNA that provide information to makeproteins. Proteins are long strings of (b)________________________
    10·2 answers
  • Consider the clinical scenario: Semen is very low in volume and the sperm cells have difficulty with motility because there isn'
    6·1 answer
  • In the previous activity, you chose an animal that interested you and listed three examples of innate behavior and three example
    11·1 answer
  • Prions are
    11·1 answer
  • "Ethnicity" of John George Haigh?​
    13·1 answer
  • Why must transcription occur where DNA can be found?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!