Which list correctly matches the function to the types of chabohydrates

Biology

1 answer:

kirza4 [7]3 years ago

3 0

Where is the picture ?

You might be interested in

Barbara is a research scientist at an organic pest control company. Part of her job is to find foods that ants will eat so the f

Alinara [238K]

Answer:

D, which food will ants consume more of-corn meal or maple syrup?

Explanation:

This makes the most sense because she's trying to create better ant baits and has no use for finding out how long it takes the ants to eat them. She's searching for the food that attracts them the most.

7 0

3 years ago

Often, the second part of a scientific name is (1 point)

lyudmila [28]

A. a description of a trait or habitat.

8 0

4 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

In this lesson, you have learned that the stomach is an organ in the digestive system that is made up of different tissues that

k0ka [10]

Answer:

The whole body works together, as a “team.”If one of the parts of the body won’t work together as a team, everything will get messed up. The stomach muscles churn and mix the food with digestive juices that have acids and enzymes, breaking it into much smaller, digestible pieces. An acidic environment is needed for the digestion that takes place in the stomach.

Explanation:

6 0

3 years ago

Read 2 more answers

Pictured is a ribosome. How are ribosomes different from most other cell organelles?

cluponka [151]

I believe c is the answer

8 0

4 years ago