1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
romanna [79]
3 years ago
14

How many stars are at the center of our solar system?

Biology
2 answers:
Dovator [93]3 years ago
8 0
200bill, probably way more
Zina [86]3 years ago
5 0

Answer:

1, the sun

Explanation:

You might be interested in
"in order for the stain to penetrate the impervious coat of the spore, which primary stain is steamed into the cell surface?"
lana66690 [7]

Answer;

-Malachite green

Explanation;

-Malachite green is also used in endospore staining, since it can directly stain endospores within bacterial cells; here a safranin counterstain is often used.

-Because of their tough protein coats made of keratin, spores are highly resistant to normal staining procedures. The primary stain in the endospore stain procedure, malachite green, is driven into the cells with heat.

7 0
3 years ago
What are some direct and indirect substances produced as a result of photosynthesis?
sertanlavr [38]

Answer:

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that can later be released to fuel the organisms' activities. This chemical energy is stored in carbohydrate molecules, such as sugars, which are synthesized from carbon dioxide and water – hence the name photosynthesis, "light", and sunthesis, "putting together". In most cases, oxygen is also released as a waste product. Most plants, most algae, and cyanobacteria perform photosynthesis; such organisms are called photoautotrophs. Photosynthesis is largely responsible for producing and maintaining the oxygen content of the Earth's atmosphere, and supplies most of the energy necessary for life on Earth.

Explanation:

8 0
3 years ago
48. Glyolysis – takes one _______ molecule and converts it two two _________________ molecules.
g100num [7]
First one is NAD+, second one is ADP
4 0
3 years ago
The unity of living systems arises through evolutionary change true or false
Xelga [282]
True. I'm 99.9% sure
7 0
3 years ago
Structure moves up against epiglottis when food is swallowed to prevent passage of food into it.
borishaifa [10]

Answer:

The correct answer is A. The larynx moves up against epiglottis when food is swallowed to prevent passage of food into it.

Explanation:

The epiglottis is a moist, cartilaginous structure that is part of the cartilaginous skeleton of the larynx. It also marks the boundary between the oropharynx and the laryngopharynx. The epiglottis obstructs the passage of the bolus at the time of swallowing preventing it from going to the respiratory system.

Larynx closure occurs when the vestibular and vocal folds approach the midline during swallowing. Occasionally, when you eat very fast, solid foods or liquids can enter the larynx.

6 0
3 years ago
Other questions:
  • Which characteristic is shared by all four cells
    5·1 answer
  • Should guys with moobs wear bras in public?
    8·2 answers
  • Name of substrate of amylase
    15·2 answers
  • one serving of a particular food contains 16g of carbohydrates, 2g of protein, and 10 g of fats. Approximately how many calories
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Plssssss helpppppppppppppppppppppppppppppppp
    6·1 answer
  • 15. Which joins amino acids together?
    6·1 answer
  • ¿cuáles fueron
    7·1 answer
  • which mechanism of action is being described when an antibiotic drug causes the destruction of bacterial cell walls
    7·1 answer
  • The set of proteins in the cristae of the mitochondrion, which collectively extract the energy from reduced coenzymes to form at
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!