1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
3 years ago
6

With respect to life expectancy, because ________ are at higher risk for disease and early death, they reap somewhat larger gene

rational gains from positive lifestyle changes and new medical discoveries.a. womenb. Japanese Americansc. middle-SES individualsd. men
Biology
1 answer:
Nataly_w [17]3 years ago
6 0

Answer:

The correct answer to fill in the blank is: D) men.

Explanation:

According to different studies made over the years, it has been revealed that men have a lower life expectancy (76 years) than women (81 years), Japanese Americans (87 years) and individuals of middle socioeconomic status.

Since men are the group with the higher risk, they can benefit more from changes in their lifestyle like exercising and having healthy diets.

You might be interested in
Help please ^w^ plz.
MrRissso [65]
1. C
2.B
3.C
4. A
5. False
6.True
7.False
8.True
9.True
10. false

Hopefully this help
4 0
3 years ago
in the northern hemisphere, a wind blowning from the south to the north will cause a current of water in which direction
hichkok12 [17]
Hello,

Here is your answer:

The proper answer to this question is "east".

Here is how:

When the wind blows from the south to the north the current of water will go to the east because of the direction of the air is blowing.

Your answer is east.

If you need anymore help feel free to ask me!

Hope this helps!
5 0
3 years ago
How many years do most volcanic hot spots<br> last?
k0ka [10]
It’d be at least 70 million years.
6 0
2 years ago
What type of cancer affects the blood-forming organs? select one:
Olenka [21]
Hey there,
The answer is leukemia
It happens when your bone marrow starts to produce to much of white blood cells that are not fully developed. Thus they cannot function properly.

Hope this helps :))

<em>~Top♥</em>
8 0
3 years ago
What would happen to the population of rock dwelling lizards if all rocks were romoved?
Mars2501 [29]
It would be renamed homeless lizards.
4 0
3 years ago
Read 2 more answers
Other questions:
  • A(n) propagates down an axon of the first neuron like a wave across the ocean until it reached a gap between neurons called
    8·1 answer
  • What is the pathway of air into the body?
    7·2 answers
  • The interdependent evolution of two interacting species is known as: A. natural selection. B. ecology. C. coevolution. D. mutual
    12·1 answer
  • Which macromolecules provide instructions for growth?
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The ph of the water in several lakes in norway and sweden had decreased to below 5.0 due to an increase in acid rain. What is mo
    13·1 answer
  • 1. Which explains why hydroelectric power has a limited future in the United States?
    13·1 answer
  • How can the appearance of white baby rabbits be explained when the mother has white fur, and the father has black fur?
    8·1 answer
  • In the solid phase , molecules are completely separate from each other
    6·1 answer
  • HELP
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!