1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stellarik [79]
3 years ago
14

What is determined by genes?

Biology
2 answers:
kondor19780726 [428]3 years ago
7 0

Answer:c the inherited traits

Explanation:

Because if you have a gene it was passed down from ancestors and you inherited it from them

slavikrds [6]3 years ago
7 0
The inherited traits stem from genes
You might be interested in
What will you observe if the air temperature Is 53F and the dewpoint is 45F?
kondaur [170]
You will some water vapour
4 0
3 years ago
Bart believes that mice exposed to radiowaves will become extra strong (maybe he's been reading too much Radioactive Man). He de
solniwko [45]

1) Mice not radio waved.

2) Radio

3) Strength of mice

4) Maybe inconclusive.

5) Improves strength

Explanation:

  1. Control Group - Mice not radio waved.
  2. Independent Variable - radio.
  3. Dependent Variable - Strength of mice.
  4. What should Bart's conclusion be? Maybe inconclusive.
  5. How could Bart's experiment be improved? Improves strength

Experimental setup

setup that is testing a hypothesis using a variable. In most cases only one variable should be tested at a time.

Control Setup

setup that is identical to the experimental setup, only it does not contain a variable.

Independent Variable

The one factor that is change by the person doing the experiment

Dependent Variable

The factor which is measured in the experiment

Constant

all the factor that stay the same in an experiment.

4 0
2 years ago
Lincoln says the "insurgents" wanted to fight. Why?
Artist 52 [7]
President Lincoln said the "insurgents" wanted to fight because they wanted to extend and perpetuate slavery. At the end of the Civil War, the "insurgents" did not get their wish. The correct answer is B.
4 0
3 years ago
BRAINLIEST
ycow [4]

Answer:

Part A: The process of sexual reproduction is important because by this process organisms with varied genetic characteristics can be formed. Crossing over and independent assortment allow individuals to be born which are not alike to another and their parents. As a result, genetic diversity is produced.

Part B:

The process 1 is meiosis. The process 3 is development by mitosis.

The reproductive organs form sperm and egg by the process of meiosis. During this process, the number of chromosomes is reduced so that the number of chromosomes of an individual can be maintained.

The zygote converts into an embryo in a process called germinal development. The zygote replicates by mitosis to form into an embryo.

3 0
3 years ago
Electron movement around the nucleus of an atom is analogous to the way_____________.A. insects fly around a bright lamp at nigh
bearhunter [10]

Answer:

A. insects fly around a bright lamp at night

Explanation:

insects are naturally attracted to light  due to presence of positive phototaxis.  Insects revolve around the light in the same way as electrons do around the nucleus.

4 0
3 years ago
Other questions:
  • It’s for 01.05 energy lab worksheet
    11·1 answer
  • What do zika, ebola, west nile, and avian influenza have in common?
    14·2 answers
  • The formation of mycorrhiza is a symbiotic relationship between plant roots and fungi.Another example of a symbiotic relationshi
    7·2 answers
  • Besides filtering blood for foreign materials and phagocytosis of old, defective erythrocytes, the spleen is also involved in wh
    8·1 answer
  • What is the main definition of the word aquifer
    8·1 answer
  • biological evolution is the process by which populations of organisms change over time. How could natural selection lead to evol
    14·2 answers
  • Natural resources in the environment must be allocated responsibly. Why is the location of resources a concern?
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • PLEASE HELP ME ASAP!!!!!!!!!!!! GIVING 15 POINTS
    9·1 answer
  • How is life going for everyone talk to me mines is saf
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!