1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
agasfer [191]
3 years ago
13

Short chains of sugars attached to proteins in the cell membrane form

Biology
1 answer:
gavmur [86]3 years ago
6 0
Nucleus. Please mark me brainliest!
You might be interested in
Write complimentary strand for the following DNA sequence: CGC ATG CAC TTC
evablogger [386]

Answer:

DNA Sequence:    CGC ATG CAC TTC

mRNA Sequence: GCG UAC GTG AAG

AA: Alanine, Tyrosine, Valine, Lysine.

Explanation:

6 0
3 years ago
Read 2 more answers
The term adenectomy means?
Gemiola [76]
Answer: D. Surgical removal of a gland.

Your welcome :)
5 0
3 years ago
Read 2 more answers
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Explain intelligence.
Naily [24]

B. The ability to respond to the environment good decision

5 0
3 years ago
What enters the heart
max2010maxim [7]

Answer:

Blood, the heart pumps oxygen-poor blood to the lungs to be oxygenated.

Explanation:

:) Merry Christmas!

3 0
3 years ago
Other questions:
  • BRAINLIESTTTT ASAP!!!
    14·2 answers
  • What amino acid residue would MOST likely be buried in the interior of a water-soluble globular protein?
    11·1 answer
  • Saddle joints have concave and convex surfaces. Name the two bones of the hand that articulate to form a saddle joint. A. The tr
    6·1 answer
  • Due to __, a million species are in danger of disappearing in 20 years
    15·2 answers
  • Jordan builds a terrarium. But, the soil he uses does not have many nutrients. How could this affect life in the terrarium?
    10·1 answer
  • 2. Codominance: Diricrawls are plump, fluffy-feathered, flightless birds. Feather color
    5·1 answer
  • Population tend to move to the average height; not too many really short ones or really tall ones. A. Directional Selection B. D
    6·1 answer
  • Which of the following materials would allow the flow of electricity?
    8·2 answers
  • Laboratory
    11·1 answer
  • What makes human beings more dominant than other species?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!