1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
larisa [96]
3 years ago
11

How does the arrangement of the atoms in a mineral relate to it properties ​

Biology
1 answer:
Lera25 [3.4K]3 years ago
8 0

The arrangement of atoms in a mineral can change its physical and chemical properties. 

Diamonds and coal are both made of carbon, however, their chemical and physical properties are very different. 

You might be interested in
How does drug use affect dopamine?
tatiyna
Drugs<span> are chemicals that </span>affect<span> the brain by tapping into its communication system and interfering with the way neurons normally send, receive, and process information. Some </span>drugs<span>, such as marijuana and heroin, can activate neurons because their chemical structure mimics that of a natural neurotransmitter.
</span>
5 0
3 years ago
Plss help me!<br><br> I need help
padilas [110]
Everything is false expect the first question and last question
5 0
3 years ago
Read 2 more answers
Joints are most important for which of the following?
Brut [27]
Diifhtisbdjdhfbjfisisjdnekifnfnfjfkdijsbebridjsjjsjdkfjgnfjskdjnrn
5 0
3 years ago
List three reasons for why Pluto was demoted to a dwarf planet.
harina [27]

Answer:

Pluto did not meet the three size criteria

Explanation:

To become a planet Pluto only missed ONE reason that resulted in demotion to a dwarf planet. The reason for that is because Pluto didnt "clear its neighbouring region of other objects."

6 0
3 years ago
Briefly describe how the nerve net of a cnidarian functions
Sladkaya [172]

A nerve net consists of interconnected neurons lacking a brain or any form of cephalization. Unlike central nervous systems, where neurons are typically grouped together, neurons found in nerve nets are found spread apart. This nervous system allows cnidarians to respond to physical contact.


4 0
4 years ago
Other questions:
  • Why don't legumes need nitrogen-containing fertilizers? Why is nitrogen so important for
    10·1 answer
  • What is the corona of the sun
    15·2 answers
  • Alcoholic fermentation
    15·2 answers
  • What class of organic compounds is composed of amino acids?
    11·1 answer
  • Which organelle takes in " sun showers" and helps plants with the process of photosynthesis?
    14·2 answers
  • Which of these molecules is not formed by dehydration reactions?
    15·1 answer
  • When one copy of a gene is turned off, this process can be due to
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is the difference between prokaryotic and eukaryotic cells?
    6·1 answer
  • The hormone _____ is secreted following consumption of a meal. This hormone stimulates the uptake and utilization of glucose by
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!