1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
2 years ago
14

Which of the following organic molecules is a source of carbon, nitrogen, and phosphorus

Biology
1 answer:
hammer [34]2 years ago
4 0

Petroleum, and carbon. It's an organic thing and has the sources provided.

You might be interested in
A population of wolves predates a population of moose on Isle Royale, Michigan, where there are fewer wolves than moose to start
andrew11 [14]

Complete question:

A population of wolves predates a population of moose on Isle Royale, Michigan, where there are fewer wolves than moose to start. The wolves prey on the moose and eat well, allowing them to have abundant offspring. However, as the wolf population rises, the moose population drops, and over time, the wolf population begins to drop also because of the reduced availability of resources. As the wolf population drops, moose are able to better survive and reproduce, causing the moose population to rise. With this abundance of moose, the wolf population is able to rebound until their population exceeds the moose population’s ability to support the number of wolves. Which population dynamic does this series of oscillations represent?

  1. Delayed density dependence
  2. Delayed density independence
  3. Extinction vortex
  4. Carrying capacity

Answer:

  1. Delayed density dependence

Explanation:

The Delayed density dependence occurs when two species are in interaction (prey-predator or parasite-host), and the dynamic of each population follows the dynamic of the other population. The natality and mortality rates of one species follow the rates of the other species.

<em>Delayed density dependence dynamics regulate populations and allow the occurrence of equilibrium or balance in nature.</em>

<u>Predator-prey scenarios</u>

Assuming that the prey lives in the ideal environment with no predators, it shows an exponential growth rate. Prey can grow, develop, and reproduce, increasing its population size. The more available items, the more predator there will be. The predator population increase in size, and its presence affects the prey populations, leading it to decrease. So there are fewer available items to prey on.    

The prey population also affects the predator population. After the increase in the predator population size, the number of available prey decreases. The predator lives in an ideal environment but depends on the prey density. The more predators there are, the fewer prey there will be left. The predator population decreases exponentially due to the item's lack. The predation rate depends on density as well as natality and mortality rates.

So, to sum up,

  1. prey population increases in size
  2. predator population increases in size
  3. prey population decreases in size
  4. predator population decreases in size

In this particular example, the wolves population follows the moose population and vice-versa. It is not simultaneous. It happens with a delay.

<em>Moose influences the wolf population because they are their source of food. The more moose, the more wolves there are. The fewer moose, the fewer wolves there are. </em>

This is a density-dependent dynamic because both populations are affected when they reach a high value.

6 0
3 years ago
Describe the order of how living things arose based on the geologic timeline?​
Anastasy [175]

Answer: Geologists and other Earth scientists use geologic time scales to describe when events happened in the history of Earth. The time scales can be used to show when both geologic events and events affecting plant and animal life occurred. The geologic time scale pictured below (Figure below) illustrates the timing of events like:

Earthquakes.

Volcanic eruptions.

Major erosion.

Meteorites hitting Earth.

The first signs of life forms.

Mass extinctions.

Explanation:

8 0
2 years ago
The steps you follow in your experiment
xz_007 [3.2K]

Answer and explanation;

The steps followed in an experiment include;

-Observation; this involves
taking note of something such as a curious phenomenon worth further thought and investigation

-Research; it involves forming a question so as to find out more about the natural phenomenon observed.

-Hypothesis, this is an informed guess as to the possible answer of the question.Its purpose is not to arrive at the perfect answer to the question but to provide a direction to further scientific investigation.

-Experiment, the hypothesis formed must be tested by conducting a well designed and controlled experiment. Its is an important step as it proves whether the hypothesis is correct or wrong.

-Analysis; it entails taking down the results and analyzing it together with the data and suing it to draw conclusion regarding the strength of the hypothesis.

-Conclusion; From the analysis a conclusion about the hypothesis can be drawn, explaining why the phenomenon occurs.

-Publish; the results may then be published as a reference and for future use and comparison.

3 0
3 years ago
Read 2 more answers
An essential nutrient is one that a) bacteria need for proper growth and can make themselves.b) bacteria need for proper growth
sergij07 [2.7K]

Answer:

The current answer is b) bacteria need for proper growth and cannot make themselves.

Explanation:

An essential nutrient is one which is required to the cell for the proper growth from the environment because it cannot be synthesized by the cell itself.

Some essential nutrients that bacteria require for their growth are carbon, nitrogen, water, iron, inorganic salts, and many other molecules.  

These nutrients should be given from an easily available source to the bacteria for their proper growth because these nutrients are required to perform essential metabolic activities and can not be synthesized by bacteria on their own.

8 0
3 years ago
Which human activity has aggravated the ecological issue of global warming?
Crank
<span>The burning of fossil fuels, deforestation (sedimentation and the following green-house gas emissions) are two examples.More-so even is the destructive effects of globalization and urbanization on the ecosystems.</span>
5 0
3 years ago
Other questions:
  • Methods used to help control invasive species
    9·2 answers
  • As humans have converted prairies to pastures and farms, prairie dogs have lost 98 percent of their habitat. Prairie dogs are th
    15·2 answers
  • How are the asthenosphere and the mantle related
    8·1 answer
  • Help me please,Thanka
    15·2 answers
  • If water moves into a cell, and the cell swells, what term describes the environment inside the cell?
    5·2 answers
  • Cyanide is a poison that inhibits the electron transport chain by creating a strong and stable bond with Fe–Cu center in cytochr
    12·1 answer
  • Which of the following is likely abiotic limiting factor of fish in a pond ecosystem? pollution
    11·2 answers
  • In addition to heat energy, another product of fires is dangerous smoke and other chemicals. this fact is the reason for a _____
    13·1 answer
  • The mutation of a cell for a specific function is called
    10·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!