1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
6

Our body temperature stays constant no matter the changes that may occur in the outer environment - for example, a hot summer af

ternoon or a cold winter morning. This is an example of _____.
Biology
1 answer:
skad [1K]3 years ago
5 0

Answer: Homeostasis

Our body temperature stays constant no matter the changes that may occur in the outer environment - for example, a hot summer afternoon or a cold winter morning. This is an example of homeostasis

Explanation:

Homeostasis is the maintenance of a stable internal environment. Hence, the body maintains a stable temperature, ph level, water-salt balance etc, necessary for healthy development based on the effects of the hormonal and nervous systems.

You might be interested in
The second stage of prenatal development begins at about two weeks after conception. at this point, the growing bundle of cells
Nata [24]
The second stage of prenatal development begins at about two weeks after conception. at this point, the growing bundle of cells is called an embryo.
7 0
3 years ago
I need help to answer this question
sdas [7]
Because it’s in smaller price so therefore can’t melt faster than the block, since the smaller peices will melt at the same time as one another.
8 0
4 years ago
A _____ is a group of present or potential customers with some common characteristic which is relevant in explaining and predict
Semenov [28]

Answer:

Market segment

Explanation:

Market segmentation is the activity of dividing a broad consumer normally consisting of existing and potential customers, into small segments of consumers with similar interests and needs. This makes you target the exact customers that will become satisfied consumers of your content. Because the segments are based on some type of shared characteristics, they allow for more precisely targeted marketing and personalized content.

3 0
3 years ago
Use the data shown to sort each of the choices into the appropriate column.
Andrej [43]

Answer:like when you have a sore throat or a kind of common sickness

Explanation:

6 0
3 years ago
An ionic bond is most likely to form between:
nignag [31]

The answer to your question is,

A) A negatively and positively charged ion.

-Mabel <3

3 0
4 years ago
Other questions:
  • Yolanda concludes that only the first and fourth chicks could be related to the mother hen. Which of the following explanations
    10·1 answer
  • Answer to describe the effects of the properties of water on living and nonliving things
    7·1 answer
  • WILL GIVE A BRAINLEST
    14·2 answers
  • Which chemical traps the light energy?<br> 1. Haemogloblin<br> 2. Chlorophyll<br> 3. Chloroform
    8·1 answer
  • Which of the following is an example of a role programmed cell death plays in maintaining homeostasis?
    15·2 answers
  • According to the food plate, which of these food groups should make up the largest portion of your diet?
    8·2 answers
  • Name the three structures of seed plants and explain their functions
    13·2 answers
  • Scientific evidence documents the pattern of evolution. The evidence exists in a variety of categories, including direct observa
    10·1 answer
  • True or False, a Salamander is an amphibian?
    11·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!