1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
3 years ago
5

What is the control group

Biology
1 answer:
qaws [65]3 years ago
5 0

Answer:

A scientific control is an experiment or observation designed to minimize the effects of variables other than the independent variable. This increases the reliability of the results, often through a comparison between control measurements and the other measurements

Explanation:

You might be interested in
1
lawyer [7]

Answer:

a creation of new plant species

4 0
3 years ago
Jake wants to enrich the nitrogen content of his soil through fixation. Which crop can he use for this purpose? wheat sugarcane
inn [45]
The appropriate answer is D. Alfalfa. Alfalfa is a legume and these plants play a key role in the nitrogen cycle. These plants house nitrogen fixing bacteria on their roots. The bacteria are housed in tiny round structures of leguminous plant roots. Once the nitrogen is fixed in the soil it can now be used by other plants to make food.  These plants include beans peas and peanuts.  <span />
6 0
4 years ago
What discoveries has space technology helped scientists with?
lilavasa [31]
I would go with the last one, allowed scientists to better identify the location of fossils and change prior scientific knowledge
5 0
4 years ago
Read 2 more answers
Which of the following statements describes a law?
Firdavs [7]

Answer:

A law is subject to change as new evidence is discovered

5 0
3 years ago
Read 2 more answers
Explain what is meant by the term essential amino acids
kogti [31]
The amino are essential to build the DNA

hopes it's help
6 0
3 years ago
Other questions:
  • Choose two forces and compare and contrast these forces. Provide two ways that they are similar and two ways that they are diffe
    14·1 answer
  • Uniform spacing patterns in plants such as the creosote bush are most often associated with _____. uniform spacing patterns in p
    12·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which of the following is a bryophyte
    11·1 answer
  • Which system allows for food to be broken down and made available for a chipmunk's body to use?
    10·1 answer
  • If you palpate the bony projection on the lateral side of your wrist, just proximal to the thumb, what part of the radius are yo
    11·1 answer
  • What is the relation between Genes and DNA?​
    15·1 answer
  • What amino acid sequence would be made from the mRNA sequence CGCUAUAGC?
    8·1 answer
  • 5. The fluid inside living things is water based. All other nutrients needed by living things erst in
    12·1 answer
  • The red blood cells and brain are two body tissues that derive most of their energy from
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!