1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Effectus [21]
2 years ago
14

Microbial proteins with a strong specificity for a target cell that exert extremely powerful, and sometimes deadly, effects on t

hat cell are called
Biology
1 answer:
Slav-nsk [51]2 years ago
6 0

Toxins are microbial proteins with a strong specificity for a target cell that exert extremely powerful and toxic effects on that cell.

<h3>What are toxins?</h3>

Toxins are molecules that are produced by certain organisms which are deadly to other organisms when these organisms come in contact with them.

Toxins are produces mostly by microorganisms as well as some plants and animals such as fishes.

Toxins are mostly proteins products are usually specific for their targets cells.

Therefore, microbial proteins with a strong specificity for a target cell that exert extremely powerful, and sometimes deadly, effects on that cell are called toxins.

Learn more about toxins at: brainly.com/question/1235358

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
2. Atoms containing the same number of<br> protons but different numbers of neutrons<br> are
steposvetlana [31]

Answer:

Isotopes are atoms of the same element that have different numbers of neutrons but the same number of protons and electrons. The difference in the number of neutrons between the various isotopes of an element means that the various isotopes have different masses.

Explanation:

<h2>Follow instagrm at ➜ mvnnyvibes</h2><h2>Follow instagrm at ➜ mvnnyvibes</h2>
4 0
2 years ago
Garlic mustard has been introduced to the beetles ecosystem. Describe what would happen to the beetles population as a result an
lbvjy [14]

Answer:

It would collapse

Explanation:

Garlic mustard also produces root exudates that inhibit the growth of important soil fungi and leaf chemicals that kill native butterfly larvae that feed on the plant

In addition, invertebrates and other consumers that rely on these natural plant species for food are harmed by the spread of this invasive "weed". Garlic mustard also produces root exudates that inhibit the growth of important soil fungi and leaf chemicals that kill native butterfly larvae that feed on the plan

4 0
3 years ago
How do atoms become the complex structures and substances around us
stich3 [128]
Atoms bound together and form molecules. Molecules are a little more complex than atoms. For example water is composed of two hydrogen atoms and one oxygen atom which are both gases. Properties of oxygen and hydrogen are completely different than water molecules.
6 0
3 years ago
Which of the following would not be an ecosystem?
nataly862011 [7]

Answer:

A light pole

Explanation:

A light pole does not contain any areas in which an organism could inhabit

A hydrothermal vent contain many bacterias which can survive under those conditions, similar to an abandoned mine

The Kowloon Walled City can be considered an ecosystem only because within the City there may be many areas in which an organism could inhabit

3 0
3 years ago
Read 2 more answers
Other questions:
  • When viewing an ap projection of the upper cervical spine open mouth technique you notice that the base of the skull is superimp
    13·1 answer
  • What do you think will happen to an egg after being in water for three days? Be sure to give a reason for your hypothesis.
    15·1 answer
  • In plants, ______________ are defined as haploid (1n) cells that develop into gametophytes. Gametophytes, in turn, produce eithe
    9·1 answer
  • Where does the Calvin cycle occur? There is a scheme of the chloroplast structure. The outer layer of the chloroplast is labeled
    10·2 answers
  • humans constantly breathe in oxygen yet the amount of oxygen in the atmosphere remain relatively constant explain why
    9·2 answers
  • Crop pollination, water purification, and moderation of weather extremes are just a few examples of __________. answer biologica
    7·1 answer
  • Chlorophyll is necessary for photosynthesis to take place because it-
    15·1 answer
  • In T-ball, batters hit a ball that is placed on a T-shaped stand. Batter A hits the ball by swinging the bat from a resting posi
    15·1 answer
  • When two protein chains combine to form an active protein, the structural level is ________
    7·2 answers
  • What is the maximum sustainable yield for a resource?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!