1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Radda [10]
3 years ago
14

Why is it important for scientists to study the causes of cancer as well as develop new treatments for cancer

Biology
1 answer:
Arlecino [84]3 years ago
3 0

Cancer kills by invading key organs (like the intestines, lungs, brain, liver, and kidneys) and interfering with body functions that are necessary to live. Untreated cancer commonly causes death. ... Even when it can't cure the cancer, treatment can often help people live longer.

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Use this portion of a dichotomous key for tree identification to answer the question.
Charra [1.4K]

Answer:

They are nonlobed, simple leaves and are attached oppositely on the branch.

Explanation:

A dichotomous key is a tool you use in biology to know the identity of things in nature such as trees,flowers, fish or even rocks. This key has choices that follow each other in a progressive manner, where one choice led to the other until you identify the item.In this case, to identify Dogwood, you follow the below steps;

1b. Broad leaf = Step 2

2b. Simple leaf = Step 7

7a. Leaf bases attached opposite each other on branch = Step 8

8b. Leaves not lobed = Step 9

9b. Leaves not heart shaped = Dogwood

The key is (1b,2b,7a,8b,9b)

8 0
3 years ago
If the first low tide occurs at 5:10 a.m. on Friday when will the next low tide occur​
jonny [76]

The correct answer is - 5:35 PM on Friday.

The low tides, as well as the high tides, occur two times in a lunar day, on exactly every half a lunar day passed. A lunar day is 24 hours and 50 minutes long, so every next low tide, or high tide, appears after 12 hours and 25 minutes after the previous one. In this situation we have a low tide that has appeared at 5:10 AM on Friday, so in order to calculate when the other low tide will appear we need to add 12 hours and 25 minutes on it, and that will gives the information that the next low tide will appear at 5:35 PM on Friday.

6 0
3 years ago
Which best describes the purpose of a controlled experiment?
leva [86]
I think the correct answer from the choices listed above is option C. The purpose of a controlled experiment is to  examine whether one variable causes a change in another. A<span>n independent variable is the only factor that is allowed to be adjusted, with the dependent variable as the factor that the independent variable will affect.</span>
5 0
3 years ago
Read 2 more answers
Where is amyglada located in a brain ? How does it function ?​
Sedbober [7]

Short Answer: The amygdala is located in the brain and its functions are related to emotional learning.

Explanation

The amygdala is a brain structure located in the temporal lobe of the brain. Its functions are related to the emotional system of the brain, and memory. In addition, the amygdala has been shown to influence the emotional learning process. The amygdala is mainly responsible for the formation and storage of memories associated with emotional events, so external sensory stimuli reach the basolateral group of the amygdala, where associations are formed with memories of the stimulus (mainly related to fear).

7 0
2 years ago
Other questions:
  • The food web illustrated above shows plants and animals, but does not indicate bacteria. If bacteria were truly missing from thi
    7·1 answer
  • Mechanoreceptors that react to changes in pressure are part of the _____
    12·2 answers
  • Lines on a weather map connecting places of equal air pressure are called ________. question 26 options: isotherms isobars isopl
    12·1 answer
  • Gregory wants to make a hole in a flat piece of wood. He places object Y on the piece of wood, and then object X on top of it.
    12·1 answer
  • Which statement correctly relates to DNA and RNA?
    13·2 answers
  • The second and fourth metacarpal bones in the horse are commonly called the A. splints. B. cannon bones. C. shins. D. navicular
    15·2 answers
  • The term trial refers to _____.
    14·2 answers
  • From food.<br> Respiration is the process in which organisms use oxygen to release from ____ food
    15·1 answer
  • Explain the protective significance of chromosomes condensing into tight coils during mitosis.
    10·1 answer
  • The diagram below shows a stack of rock layers. These layers have not changed position since they formed. Examine the diagram an
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!