1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ratling [72]
3 years ago
13

What are The categories of epithelial tissues membrane are

Biology
1 answer:
elena55 [62]3 years ago
5 0
Epithelial membranes are made from epithelial tissue attached to a layer of connective tissue. There are three types of epithelial membranes: mucous, which contain glands; serous<span>, which secrete fluid; and </span>cutaneous<span> which </span>makes<span> up the skin. </span>
You might be interested in
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
After the bank robbery, the very frightened people probably experienced increased activation of the sympathetic nervous system,
nata0808 [166]
The answer is Adrenaline

Adrenaline is a stress hormone secreted by the adrenal glands and some other neurons when a person is frightened, excited or generally in stress.

It prepares our body for it's 'fight or flight' mechanism and tightens muscles for exertion.

After a bank robbery, most people feel a rush of adrenaline.
<span />
7 0
3 years ago
The graph below shows the expected lifespan of diabetic individuals before and after the
DENIUS [597]

Answer:

It increased their life expectaion.

Explanation:

It says it on the graph.

3 0
3 years ago
Read 2 more answers
The genes in the DNA store information about how to manufacture proteins. If we think of these instructions like a chocolate chi
Lapatulllka [165]
D. choosing which type of chocolate to use
8 0
3 years ago
Is the ganglia in the PNS or CNS
tatuchka [14]
Ganglia is in the PNS.
6 0
3 years ago
Read 2 more answers
Other questions:
  • 3. Student sees the “new kid” sitting alone at lunch and decides to sit and eat with them.
    13·1 answer
  • How many total pairs of the highlighted muscle does each individual have?
    7·1 answer
  • What type of liability may a radiographer be held responsible for if they restrain a patient without a physicians order?
    10·1 answer
  • White stallion: Bbcc
    8·1 answer
  • Alphonse suffered a stroke, resulting in a lesion in his temporal lobe. Which of Alphonse’s perceptual or cognitive functions is
    5·1 answer
  • compare and contrast the traits and growth patterns of oppertunistic versus equilibrium populations. provide examples
    8·1 answer
  • If you have the two traits for a plant include T-tall, t-short, G-green seed and g-yellow seed. If you cross a homozygous tall,
    7·1 answer
  • PLEASE HELP!!!! In order for air to flow out of the lungs, pressure outside must be_________pressure in the lungs.
    10·2 answers
  • How many teaspoons does it take to get 9 table spoons?
    6·2 answers
  • All that apply<br> Light has properties of both<br> and
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!