1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
2 years ago
15

The main difference between early and late selection models of attention is that in late selection models, selection of stimuli

for final processing doesn't occur until the information is analyzed for __________.
Biology
1 answer:
DerKrebs [107]2 years ago
5 0

Answer:

B. meaning

Explanation:

Here is the complete question:.

The main difference between early and late selection models of attention is that in late selection models, selection of stimuli for final processing doesn't occur until the information is analyzed for

A. modality.

B. meaning.

C. physical characteristics.

D. location.

B. meaning

You might be interested in
How do amino acids join to form proteins
ser-zykov [4K]

Answer:

Inside your cells, the individual amino acids can bond together by forming a peptide bond, which is simply a chemical bond that joins amino acids together. More specifically, peptide bonds join the carboxyl group of one amino acid with the amino group of another.

HOPE THIS HELPED!!!!!!!!!XDDDDD

3 0
3 years ago
Read 2 more answers
Ian experiences pain in his leg after a fall, so he goes to the doctor. After an exam, the doctor explains to Ian that he has in
Anna11 [10]

Answer:

Tendon or a connective tissue

Explanation:

Tendons are a type of connective tissue that attaches muscle to bones. They are strong, fibrous and flexible. They also attach muscles to other organs. Tendons have a high tensile strength which is useful to withstand muscle contractions. They are made up of bundles of connective tissue that contribute to its strength.

5 0
3 years ago
Which encompasses the greatest diversity of species?
sweet [91]
I believe it is class, because species are divided into different classes, but families, for example: there's the cat family, and there's the dog family. classes: the carnivores, herbivores, omnivores OR mammals, egg laying, or hermaphrodites

8 0
3 years ago
Where does energy flow from
Vlad1618 [11]

Answer:

the sun hot stuff

4 0
3 years ago
Read 2 more answers
What is being put together, with the help of light, in the process of photosynthesis?
snow_lady [41]

Answer:

oxygen, and energy (ATP)

4 0
3 years ago
Other questions:
  • Which is a leading theory for the formation of fossil fuels?
    6·1 answer
  • Why do astronomers use X Ray telescopes to study supernova explosions and black holes
    5·1 answer
  • Trees do not move like birds do but they are living things. why
    7·1 answer
  • Which qualities would be best for someone working in Support Services?
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Does anyone know the answers?
    13·1 answer
  • Why do melting ice caps make Earth warmer?
    12·2 answers
  • How does cooking eggs in a microwave compare with cooking eggs on top of the stove?
    11·2 answers
  • Because cells come from other cells,
    13·2 answers
  • My inner mouth is bite by my own teeth is it dabgerous​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!